| |
Improvements in lipoatrophy, mitochondrial DNA levels and fat apoptosis after replacing stavudine with abacavir or zidovudine
|
| |
| |
AIDS: Volume 19(1) 3 January 2005
You can read below the Abstract, Author Discussion, and Study methods & Results. And an Editorial by Kees Brinkman.
McComsey, Grace Aa,b; Paulsen, Denise Mc; Lonergan, J Tylerd; Hessenthaler, Siegrid Mc; Hoppel, Charles Lb; Williams, Vanessa Cc; Fisher, Robin Lc; Cherry, Catherine Le; White-Owen, Cathyb; Thompson, Katherine Ae; Ross, Steve Tc; Hernandez, Jaime Ec; Ross, Lisa Lc
aRainbow Babies and Children's Hospital
bCase School of Medicine Center for AIDS Research, Cleveland, Ohio
cGlaxoSmithKline
dUniversity of California, San Diego, California, USA
eMonash University and the Burnet Institute, Melbourne, Australia
Sponsorship: Supported by GlaxoSmithKline. ABC and ZDV were supplied by GlaxoSmithKline. G. McComsey received grant support, is a consultant and serves on the Speaker Bureau for GlaxoSmithKline, Bristol-Myers Squibb, Agouron/Pfizer and Merck Sharp & Dohme. J. T. Lonergan is a consultant for GlaxoSmithKline, Gilead Sciences and Abbott Laboratories. D. M. Paulsen, V. C. Williams, R. L. Fisher, S. T. Ross, S. M. Hessenthaler, J. E. Hernandez and L. L. Ross are/were employees of GlaxoSmithKline during the conduct of the study.
Abstract
Objective: To determine if stavudine (α4T)-associated mitochondrial toxicity could be reversed by substitution with another nucleoside reverse transcriptase inhibitor. As apoptosis and dysfunction of electron transport chain (ETC) activities may underlie mitochondrial toxicity, these parameters were also evaluated.
Design: The 16 participants (on d4T for >3 years; with lipoatrophy and/or hyperlactatemia) substituted abacavir or zidovudine for stavudine in their antiretroviral regimen. Key parameters including dual-energy X-ray absorptiometry (DEXA) scans, fat apoptosis, mitochondrial DNA (mtDNA) content in peripheral blood mononuclear cells (PBMC), skeletal muscle and fat, as well as skeletal muscle mitochondrial ETC activities were evaluated at study entry and at 48 weeks after the substitution.
Methods: Quantitative PCR was used to evaluate mtDNA levels and the presence of deletions/rearrangements; CLIA-validated methods for ETC activities; terminal deoxynucleotidyl transferase dUTP-digoxigenin nick-end labeling assays to evaluate adipocyte apoptosis; and DEXA scans to measure changes in body fat.
Results: MtDNA was depleted at study entry in muscle, adipose tissue and PBMC but levels rebounded with respective mean increases of 141%, 146%, and 369% at week 48. Corresponding fat improvements were noted with DEXA increases of 21%, 11%, and 16% in arm, leg, and trunk, respectively. Quantitative adipocyte apoptosis were significantly increased at baseline (P < 0.01 versus HIV-negative controls), with a significant reduction at week 48 (P < 0.05 versus baseline). Mean values for seven mitochondrial enzyme activities assays at entry indicated substantial loss of function (48% to 85% of controls) with significant improvement of complex I activity by week 48.
Conclusions: Substitution of stavudine with abacavir or zidovudine improves mitochondrial indices and fat apoptosis in the setting of lipoatrophy.
AIDS: Volume 19(1) 3 January 2005
Lipoatrophy and mitochondrial DNA assays: see all, know all?
Brinkman, Kees
From the Department of Internal Medicine, Amsterdam, the Netherlands.
In 1999 we hypothesized that nucleoside analogue reverse transcriptase inhibitors (NRTI) might play an important role in the pathogenesis of lipodystrophy with mitochondrial dysfunction through the inhibition of DNA polymerase gamma [1]. By now, both cross-sectional and (retrospective analyses of) randomized studies have indeed shown that NRTI, in particular stavudine, are clearly associated with the development of lipoatrophy over time. Recently, the only prospective study of this kind, comparing tenofovir with stavudine, endorsed these earlier findings [2]. Furthermore, at adipose-tissue level, it was shown that especially in patients with exposure to stavudine, serious depletion of mitochondrial DNA (mtDNA) occurred [3-7], as well as mitochondrial dysfunction [8]. Finally, in three prospectively conducted studies, a moderate increase of peripheral subcutaneous fat was observed, when patients suffering lipoatrophy switched away from stavudine [9-11].
In this issue of the journal, McComsey et al. further elaborate on one of these switching studies (TARHEEL), providing the link between these clinical observations and the earlier observed stavudine-induced mtDNA depletion. In a substudy on 16 patients, they demonstrate in adipose tissue the restoration of depleted mtDNA after stavudine was switched to abacavir, as well as some improvement in mitochondrial function (complex I). Furthermore, they add further proof to earlier observations [12] that increased apoptosis might be the final pathway into lipoatrophy, which decreased after stavudine was changed.
Studies like these are difficult to perform: material is obtained by invasive procedures and especially in prospective studies, this approach requires motivated collaboration of the patients involved. Furthermore, samples are very often too small to check for the texture of the tissue or to perform extra (duplicate) tests. Especially in patients with lipoatrophy, one might easily have an overrepresentation of connective tissue, since most adipocytes might have disappeared by then. Comparing samples between individuals (especially patients versus healthy controls) without exploring these heterogeneities, makes good interpretation delicate. Connective tissue cells (fibroblasts etc) contain much less mitochondria (and mtDNA) than adipocytes. In the present study, the fact that longitudinal samples were taken in the same patients, covers these caveats in part.
To overcome this tissue sampling problem, many investigators have used more accessible tissue: blood. Studies have already been published [13,14], evaluating the effects of NRTI on mtDNA in peripheral blood mononuclear cells (PBMC) and expensive assays have been commercialized and advocated for routine patient care. However in a recent evaluation among laboratories, the same samples showed considerable variance of 96% (non-log transformed values) in measuring mtDNA content [15]. Furthermore, as was discussed for adipose tissue, PBMC also form a heterogeneous population of different cells (B- and T-lymphocytes, monocytes etc.), all in different stages of activation. Since the kinetics of mtDNA and mitochondrial proteins in these different cell-types are unknown, simply measuring mtDNA content in PBMC, without performing the appropriate checks for homogeneity, will too easily lead to conflicting results [7,16]. In fact, McComsey et al. found some increase of mtDNA content in PBMC after switching stavudine for abacavir, while Hoy et al. were unable to find such an improvement in a similar switching study [17]. Finally, untreated HIV-infected patients have been found to have 'lower mtDNA' content in PBMC than healthy controls [18] and spontaneous improvement of mtDNA in PBMC to pretreatment (or higher) levels was noted without any interruption of the previously mtDNA-depleting antiretroviral drug combination [19]. These reports underscore the need for controlling samples both for cell-type as well as for activation status before conclusions can be made.
For the future, only studies, that analyse drug toxicity in detail at the level of the representative tissue involved will finally teach us the definite aetiology of lipoatrophy.
References
1. Brinkman K, Smeitink JA, Romijn JA, Reiss P. Mitochondrial toxicity induced by nucleoside-analogue reverse-transcriptase inhibitors is a key factor in the pathogenesis of antiretroviral-therapy-related lipodystrophy. Lancet 1999; 354:1112-1115.
2. Gallant JE, Staszewski S, Pozniak AL, DeJesus E, Suleiman JM, Miller MD, et al. Efficacy and safety of tenofovir DF vs stavudine in combination therapy in antiretroviral-naive patients: a 3-year randomized trial. JAMA 2004; 292:191-201.
3. Shikuma C, Hu N, Milne C, Yost F, Waslien C, Shimizu S, et al. Mitochondrial DNA decrease in subcutaneous adipose tissue of HIV-infected individuals with peripheral lipoatrophy. AIDS 2001; 15:1801-1809.
4. Walker UA, Bickel M, Lutke Volksbeck SI, Ketelsen UP, Schofer H, Setzer B, et al. Evidence of nucleoside analogue reverse transcriptase inhibitor-associated genetic and structural defects of mitochondria in adipose tissue of HIV-infected patients. J Acquir Immune Defic Syndr 2002; 29:117-121.
5. Cherry CL, Gahan ME, McArthur JC, Lewin SR, Hoy JF, Wesselingh SL. Exposure to dideoxynucleosides is reflected in lowered mitochondrial DNA in subcutaneous fat. J Acquir Immune Defic Syndr 2002; 30:271-277.
6. Nolan D, Hammond E, Martin A, Taylor L, Herrmann S, Mckinnon E, et al. Mitochondrial DNA depletion and morphologic changes in adipocytes associated with nucleoside reverse transcriptase inhibitor therapy. AIDS 2003; 17:1329-1338.
7. van der Valk M, Casula M, Weverling GJ, van Kuijk C, van Eck-Smit BLF, Hulsebosch HJ, et al. Prevalence of lipoatrophy and mitochondrial DNA content of blood and subcutaneous fat in HIV-1-infected patients randomly allocated to zidovudine- or stavudine-based therapy. Antivir Ther 2004; 9:385-393.
8. Hammond E, Nolan D, James I, Metcalf C, Mallal S. Reduction of mitochondrial DNA content and respiratory chain activity occurs in adipocytes within 6-12 months of commencing nucleoside reverse transcriptase inhibitor therapy. AIDS 2004; 18:815-817.
9. Martin A, Smith DE, Carr A, Ringland C, Amin J, Emery S, et al. Reversibility of lipoatrophy in HIV-infected patients 2 years after switching from a thymidine analogue to abacavir: the MITOX Extension Study. AIDS 2004; 18:1029-1036.
10. McComsey GA, Ward DJ, Hessenthaler SM, Sension MG, Shalit P, Lonergan JT, et al. Improvement in lipoatrophy associated with highly active antiretroviral therapy in human immunodeficiency virus-infected patients switched from stavudine to abacavir or zidovudine: the results of the TARHEEL study. Clin Infect Dis 2004; 38:263-270.
11. Moyle GJ, Baldwin C, Langroudi B, Mandalia S, Gazzard BG. A 48-week, randomized, open-label comparison of three abacavir-based substitution approaches in the management of dyslipidemia and peripheral lipoatrophy. J Acquir Immune Defic Syndr 2003; 33:22-28.
12. Domingo P, Matias-Guiu X, Pujol RM, Francia E, Lagarda E, Sambeat MA, et al. Subcutaneous adipocyte apoptosis in HIV-1 protease inhibitor-associated lipodystrophy. AIDS 1999; 13:2261-2267.
13. Côté HCF, Brumme ZL, Craib KJP, Alexander CSA, Wynhoven B, Ting L, et al. Changes in mitochondrial DNA as a marker of nucleoside toxicity in HIV-infected patients. N Engl J Med 2002; 346:811-820.
14. Reiss P, Casula M, de Ronde A, Weverling GJ, Goudsmit J, Lange JM. Greater and more rapid depletion of mitochondrial DNA in blood of patients treated with dual (zidovudine+didanosine or zidovudine+zalcitabine) vs. single (zidovudine) nucleoside reverse transcriptase inhibitors. HIV Med 2004; 5:11-14.
15. Hammond EL, Sayer D, Nolan D, Walker UA, Ronde A, Montaner JS, et al. Assessment of precision and concordance of quantitative mitochondrial DNA assays: a collaborative international quality assurance study. J Clin Virol 2003; 27:97-110.
16. Cossarizza A, Riva A, Pinti M, Ammannato S, Fedeli P, Mussini C, et al. Increased mitochondrial DNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy. Antivir Ther 2003; 8:315-321.
17. Hoy JF, Gahan ME, Carr A, Smith D, Lewin SR, Wesselingh S, et al. Changes in mitochondrial DNA in peripheral blood mononuclear cells from HIV-infected patients with lipoatrophy randomized to receive abacavir. J Infect Dis 2004; 190:688-692.
18. Miro O, Lopez S, Martinez E, Pedrol E, Milinkovic A, Deig E, et al. Mitochondrial effects of HIV infection on the peripheral blood mononuclear cells of HIV-infected patients who were never treated with antiretrovirals. Clin Infect Dis 2004; 39:710-716.
19. Petit C, Mathez D, Barthelemy C, Leste-Lasserre T, Naviaux RK, Sonigo P, et al. Quantitation of blood lymphocyte mitochondrial DNA for the monitoring of antiretroviral drug-induced mitochondrial DNA depletion. J Acquir Immune Defic Syndr 2003; 33:461-469.
Introduction
Nucleoside reverse transcriptase inhibitors (NRTI) have been shown to cause mitochondrial dysfunction in vitro [1,2] and several clinical toxicities including lactic acidosis, hepatic steatosis, peripheral neuropathy, and myopathy which have been linked to mitochondrial dysfunction [3]. Recent studies have suggested that NRTI-related mitochondrial dysfunction plays a major role in lipoatrophy [4-6] and have identified stavudine (d4T) as a particular risk factor [7,8]. Indeed, d4T has been shown to induce a higher degree of mitochondiral (mt)DNA depletion than other NRTI, such as zidovudine (ZDV) and abacavir (ABC) [9,10]. In addition to mtDNA depletion, studies have found mtDNA deletions, functional mitochondrial abnormalities and fat apoptosis in subjects with lipoatrophy [4,6,11]. It has been suggested that fat apoptosis in lipoatrophy could be linked to cytokine dysregulation [12].
We and others [13-15] have shown that subcutaneous lipoatrophy improves after substitution of d4T for ABC or ZDV. We designed this present study to assess the reversibility of abnormal mitochondrial indices in a group of 16 HIV-infected patients who had been on d4T for over 3 years and who had lipoatrophy and/or hyperlactatemia. Fat apoptosis, mtDNA content in peripheral blood mononuclear cells (PBMC), skeletal muscle and fat, muscle mitochondrial electron transport chain (ETC) activities and cytokine expression in adipose tissue were evaluated at study entry and 48 weeks after substitution of d4T with ABC or ZDV.
AUTHOR DISCUSSION
While several studies have shown that in the setting of lipoatrophy, the substitution of abacavir or ZDV for d4T improve subcutaneous fat content [13-15] the potential for reversibility of abnormal mitochondrial indices and fat apoptosis after such interventions has not been previously investigated. In our study, we chose to switch from d4T to ABC or ZDV because several studies have shown that d4T has a more deleterious effect on mitochondria than either ABC or ZDV [1,21]. ZDV was permitted for those patients who elected not to take ABC. Since only two of the 16 patients switched to ZDV, the results for these two patients were not analyzed separately; however, they did not differ noticeable from those of subjects who switched to ABC (data not shown).
In this study, we showed a depletion of mtDNA content and alteration of mitochondrial function in d4T-treated patients with lipoatrophy, and a partial reversion after substitution of d4T with ABC or ZDV for 48 weeks. Unfortunately, only two subjects switched d4T to ZDV, precluding us from making any separate observation regarding the d4T to ZDV switch intervention. In the main TARHEEL study, we had shown that d4T switch to ZDV led to improvement of subcutaneous fat, although not to the level seen with d4T to ABC switch [14].
Due to its non-invasive nature, mtDNA content in blood fractions has been investigated in several studies as a marker of mitochondrial toxicity with conflicting results [22-25]. In our study, the findings of mtDNA depletion at baseline are consistent with prior studies which found mtDNA depletion in blood and/or fat [4,26,27]. The current study evaluated three tissue types (muscle, adipose tissue, and PBMC) concurrently from each patient to provide a more global assessment of the effect of NRTI on mitochondria and to determine if there is tissue specificity in mitochondrial dysfunction or recovery. In addition, functional assessment of mitochondria is not standardized in blood or fat, and therefore sampling of muscle was necessary. Substantial mean increases in the levels of mtDNA (141, 146, and 369%) from baseline were observed at week 48 in muscle, adipose tissue, and PBMC, respectively. These levels were consistent with previously published data on adipose tissue of patients with lipoatrophy [4,26]. The respective percent of the HIV negative control values were 96%, 47%, and 57% at week 48. Interestingly, we did find a significant correlation between on-study changes in muscle mtDNA and on-study changes in both PBMC and fat mtDNA, the latter two being easier compartments to access in clinical practice.
Consistent with prior studies [4,25], we found no large deletions or rearrangements of the mitochondrial genome at baseline or week 48 for any of the patients or controls.
While the minimum mtDNA content (threshold level) for normal function has not been established, the substantial increases seen in this study indicate considerable recovery and also point to the marked level of depletion after 3 years on d4T-containing antiretroviral therapy. In inherited mitochondrial diseases, severe symptoms usually occur when mtDNA are depleted to approximately 20% of normal, although this threshold seems to depend on the tissue examined [28]. This threshold has not been yet established in fat tissues.
There has been one previous study examining muscle ETC activities in HIV-infected patients and deficiencies were noted [6]. Our study was consistent in revealing similar deficiencies at study entry. Surprisingly, 48 weeks following the NRTI switch, only the activity of complex I improved. While the mitochondrial compensatory mechanisms are robust, these patients may have reached levels of depletion that could not be compensated. Alternatively, reversal of mitochondrial dysfunction may take longer than 48 weeks to occur. Lastly, as had been previously suggested [25,29], mtDNA depletion may not be the sole mechanism involved in the NRTI-induced mitochondrial dysfunction.
Another intriguing finding is the lack of correlation between changes in muscle mtDNA and citrate synthase activity, the latter being widely used as an indirect measure of mitochondrial mass [30-32]. Despite improvement in mtDNA, citrate synthase remained unchanged. This enzyme is coded in the nucleus, produced in the cytoplasm, and then incorporated into the mitochondria. Therefore, it is conceivable that the defect in NRTI-associated mitochondrial dysfunction could be linked at least partly to a defect in nuclear DNA.
Increases in mitochondrial content were associated with increases in arm, leg, and trunk adipose tissue of 21%, 11%, and 16%, respectively. This suggests that the recovery of mitochondrial content may be a factor in the reversal of lipoatrophy. Moyle had suggested that the significant increase in limb fat seen in his study after d4T substitution to ABC may be linked to the observed decrease in CD4 cells [15]. Our study suggests otherwise, since the improvement in fat was not associated with either changes in CD4, HIV RNA, nor with changes in fat levels of 12 measured cytokine mRNAs. This suggests that the improvement seen in fat more probably reflects the consequence of improved mitochondria, rather than the effect of immune reconstitution.
Recent studies suggested apoptosis, rather than necrosis to be the primary mechanism involved in lipoatrophy [11,33]. In this study, increased levels of adipocyte apoptosis along with decreased mtDNA were noted in adipose tissue from d4T-treated subjects with lipoatrophy relative to uninfected controls. We showed that 48 weeks after substituting ABC or ZDV for d4T, fat apoptosis was reduced to levels seen in HIV-negative controls and fat mtDNA was significantly increased along with improvement in DEXA measured regional body fat. These findings suggest that adipocyte apoptosis secondary to mitochondrial toxicity may be an underlying mechanism for lipoatrophy, and that this toxicity is reversible after switching patients from d4T to ABC or ZDV. Domingo found no changes in fat apoptosis in subjects who switched the PI to nevirapine [34]. Our study is the first to show improvement of fat apoptosis after an intervention for lipoatrophy, and suggest that the increased apoptosis observed in lipoatrophy is due to the NRTI component.
There are a number of limitations to this study, including the small number of subjects and the uncontrolled design. It is important to recognize the major feasibility issues that one encounters when trying to conduct controlled studies that involve such invasive procedures.
In conclusion, the observations in this d4T-treated cohort of patients with evidence of lipoatrophy and/or hyperlactatemia suggest that it is possible to at least partially reverse the mitochondrial dysfunction and fat loss associated with d4T use by substitution with ABC or ZDV. Larger and longer studies are needed to elucidate the mechanisms involved in both the initial depletion and recovery of mitochondrial function.
Results
Sixteen subjects participated in the substudy, and 12 underwent repeat tissue sampling at week 48. An additional subject had PBMC analyzed at week 48. Demographics for the substudy subjects are presented in Table 1 along with the 118 subjects who participated in the main study. At entry, 15/16 (95%) were on a protease inhibitor (PI) and 7/16 (44%) were on a non-nucleoside reverse transcriptase inhibitor. Antiretroviral therapy was maintained throughout the 48 weeks of the study in all subjects. All 16 substudy subjects and 97% (114/117) of the main study participants had lipoatrophy. Substudy subjects were comparable to those in main study with no notable selection bias. All 16 substudy subjects had been on d4T for at least 3 years, and seven of them had hyperlactatemia, with at least one symptom suggestive of mitochondrial toxicity. Undetectable HIV-2 RNA levels were maintained throughout the study with median levels of 1.69 log10 copies/ml for at study entry and week 48.
No subject developed serious adverse events as a result of the procedures. Most subjects developed self-limited pain at the site of the incisions. Six subjects developed small painless seromas at the site of the incision; uncomplicated needle aspiration was required in one subject.
Results of serial DEXA scans are shown in Fig. 1. Median increases from baseline in arm, leg, trunk, and total limb adipose mass of 21%, 11%, 16%, and 15%, respectively were seen at week 48 (arm P = 0.101; leg P = 0.101; trunk P = 0.006; limb fat P = 0.068) from baseline. At week 48, weight, body mass index, fasting lipids and pyruvate were not significantly different from baseline. Lactate levels significantly decreased (change from baseline -0.40; P = 0.012).
MtDNA levels were determined in fat, muscle and PBMC at study entry week 0 (n = 16) and at week 48 (n = 12). The fat specimen of one of the 12 subjects who underwent repeat biopsies at week 48 was lost. The control samples included PBMC (n = 30), muscle (n = 13), and adipose tissue (n = 25) from HIV-uninfected donors. Tissue samples of fat and muscle from uninfected donors were in the same age range ± 5 years as the 16 patients. As seen in Fig. 2a, the mean patient (n = 16) week 0 mtDNA/cell in PBMC was 64, but rose by week 48 to 256 (n = 13, P < 0.0001). The mean PBMC mtDNA/cell was 448 in HIV-negative controls. There is no overlap between the week 0 and week 48 PBMC 95% CI, or between the HIV-negative control mtDNA and the week 0 patient mtDNA confidence intervals.
As seen in Fig. 2b, mean muscle mtDNA/cell was 2305 at week 0 (n = 16), and rose to 3754 at week 48 (n = 12, P = 0.11 versus week 0). The mean muscle mtDNA/nuclei was 3927 for the HIV-negative donors. 95% CI are shown with the mean value.
Comparable results for adipose tissue are shown in Fig. 2c. The mean week 0 mtDNA/adipose tissue cell ratio was 194 (n = 16), and rose at week 48 to 430 mtDNA/cell (n = 11, P = 0.01 versus week 0). The mean mtDNA/adipose tissue cell was 921 copies/cell for the HIV-negative controls. 95% CI are shown with each mean value in Fig. 2, and do not overlap.
We conducted an analysis to determine the correlations between mtDNA levels in the three compartments examined (muscle, fat and PBMC) at baseline and week 48 as well as changes in levels on-study. The strongest correlations found were between mtDNA in fat and mtDNA in PBMC at baseline (correlation coefficient, 0.718; P = 0.0017), between change from baseline in mtDNA in muscle and change from baseline in mtDNA in PBMC (correlation coefficient, -0.664; P = 0.0185), and between change from baseline in mtDNA in fat and change from baseline in mtDNA in muscle (correlation coefficient, -0.600; P = 0.05). The correlation coefficient between change from baseline in mtDNA (adipose tissue) and mtDNA (PBMC) was 0.218; P = 0.519.
No large mitochondrial genomic deletions or rearrangements were detected for study subjects or controls.
The results of the TUNEL assay are summarized in Fig. 3. Enough adipose tissues for apoptosis assays were available from 13 subjects at week 0, 10 at week 48, and 20 uninfected controls. The analysis of three additional week 0 samples and two week 48 samples were inconclusive due to minimal numbers of adipocytes present in the fixed sections. Few apoptotic adipocytes were seen in samples from HIV uninfected controls (median score 0.5, n = 20). Tissue from subjects on d4T with lipoatrophy was found to have many apoptotic cells (median score 2, n = 13.) and this appeared to reduce following cessation of stavudine, with a median apoptosis score of 1.25 in fat biopsies collected 48 weeks after switching stavudine to another NRTI.
The results of all skeletal muscle ETC activities are summarized in Table 2. At study entry, mitochondrial dysfunction was evident; mean baseline values for ETC activities (complex I-IV) ranged from 48% to 85% of the mean levels observed in controls. The most consistent alterations were noted with complexes I and III. Depressed citrate synthesis was also observed reflecting a quantitative loss of mitochondrial mass. Significant respiratory chain dysfunction was noted in 7/16 subjects at week 0, and 3 had very marked deficiencies in at least two enzyme assays. Results of the enzyme activities are shown as mean ± SD; the unit is nmol/min/g wet weight. As seen in Fig. 4, there was significant improvement in NCR at week 48 which reflects activity of complex I and III, from 0.6 ± 0.5 at baseline to 0.9 ± 0.6 at week 48; P = 0.020). In contrast, significant worsening in complex III activity was seen; 6.0 ± 3.9 at week 48 versus 12.3 ± 5.5 at baseline; P = 0.027. Other changes in enzyme activities were not significant. These results were similar when analyzed using absolute values, or relative values after normalization for citrate synthase, which adjusts for mitochondrial number.
Immunologic assessments included CD4 cell counts and measurements of adipose tissue levels of 12 cytokine mRNAs. All of these indices remained unchanged compared to week 0 (data not shown).
Materials and methods
Subjects in this study were a subgroup of the GlaxoSmithKline-sponsored ESS40010 (TARHEEL) study that enrolled 118 HIV-infected subjects with lipoatrophy and/or hyperlactatemia who had been on d4T for at least 6 months [14]. Participation in the substudy was based on the ability to perform biopsies at the sites and the subjects' willingness to participate. Substudy sites included Case Western Reserve University, Cleveland, Ohio (n = 10), UCSD Antiviral Research Center in San Diego, California (n = 4), Boriken Neighborhood Health Center, New York, (n = 1), and Bronx VA Medical Center, New York, (n = 1). Local investigators were given the option to substitute either ABC or ZDV for d4T, and all but two subjects were switched to ABC. Adipose and muscle tissues were obtained from HIV-1 negative donors (ZEN-BIO, inc., Ardais, ABS) who were otherwise undergoing elective cosmetic surgery. PBMC were also obtained from HIV-1 negative donors at both Case Western Reserve and GlaxoSmithKline. No attempt was made to match age groups for PBMC in the HIV negative volunteers.
Measurements of all indices were taken at baseline (study entry) during therapy with d4T, and at 48 weeks after substitution of d4T with ABC or ZDV. Informed consent was obtained from patients according to the human experimentation guidelines of the US Department of Health and Human Services and those of the participating institutions.
Tissue sampling and DNA extraction
Each subject underwent fat and muscle biopsies at study entry and had 10 ml of venous blood extracted for PBMC isolation. Twelve subjects underwent repeat sampling at week 48 of the study. One subject refused biopsies but did have PBMC mtDNA performed, and three discontinued prematurely from the study. The biopsies were done in the operating room under heavy sedation with local anesthetic injected only above the fascia, so not to impair ETC activities. The protocol called for the incision to be made in the lateral thigh and the vastus lateralis muscle to be sampled. Subcutaneous fat was removed during the same surgical procedure. All tissue samples were stored at -80 °C and not thawed prior to analysis, at which time the tissue was carefully dissected to remove any visible extraneous non-fat tissue. DNA was extracted from PBMC and biopsies of adipose and muscle tissue at baseline and at 48 weeks for mtDNA analysis. As controls, the same tissue types were also analyzed for mtDNA levels in HIV-uninfected donors in the same age range. PBMC were isolated from whole blood using lymphocyte separation media (LSM, ICN/Cappel, Aurora, Ohio, USA). Cells were then washed three times in D-PBS at room temperature and centrifuged at 260 g for 15 min, depleting platelets by 20% prior to extraction. Total DNA was extracted from approximately 25 mg of tissue or from PBMC isolated from 2 ml whole blood using the QIAamp DNA Mini Kit (Qiagen Inc. California, USA).
Assessment of changes in body fat
Changes in physical signs of lipoatrophy were assessed by full-body dual-energy X-ray absorptiometry (DEXA) (Hologic QDR-4500A, Hologic, Inc., Waltham, Massachusetts, USA) at baseline and week 48. At the same time points, assessments of weight and body mass index were performed.
Mitochondrial DNA quantification
Quantitative PCR was performed on serial dilutions (1 to 1:100) of total DNA from PBMC, adipose and muscle tissue. MtDNA and genomic DNA from experimental samples were assayed by real-time PCR using an ABI7900 analyzer (Applied Biosystems Inc., California, USA) and the results compared against standard curves generated using plasmid controls for both mtDNA and nuclear genes. The number of mtDNA genomes was calculated per nuclear genome and converted to mitochondrial copies per cell for fat and PBMC, and per genomic equivalent for muscle, which is multi-nucleated [16].
Assay for large deletions or rearrangements
Analysis for the presence of large rearrangements and deletions was performed by amplifying a 120-bp area of the 16S rRNA gene and a 225-bp area in a region included in all three of the major mtDNA deletions. Two primer probe sets: GWmt18F (AAAAGTAAAAGGAACTCGGCAAA) / GWmt19R (AGGGTACCGCGGCCGT) / GWmt20P (FAM-AGCATCACCAGTATTAGAGGCACCGC-QSY) and GWmt10F (CCTGTAGCATTGTTCGTTACATGG) / GWmt11R (TGTTGGCATCTGCTCGGG) / GW14P (FAM-TCATCGGCTGAGAGGGCGTAGGA-QSY) were used. Samples were run in triplicate on an ABI 7900 and ratios of the resulting counts were compared to that of pooled putative normal donors. These results were confirmed using long extension PCR in separate PCR reactions using three different mitochondrial primers sets which would result in PCR products of 6.5, 10.4 and 14.3 kb, respectively if no rearrangements were present, and 3.9 kb if rearrangements were present.
Adipocyte apoptosis assays
The degree of subcutaneous adipocyte apoptosis was assessed by terminal deoxynucleotidyl transferase dUTP-digoxigenin nick-end labeling (TUNEL) of fixed sections of fat from study subjects and HIV-uninfected controls. Histology was assessed by a pathologist blinded to date of specimen collection, as well as to clinical and treatment details. The degree of apoptosis was graded from 0 (no TUNEL-positive cells) to 3 (most adipocytes TUNEL positive). Duplicate slide scores were averaged. In addition, quantitative analysis of apoptotic adipocytes per unit area of adipose tissue was performed using video image analysis by a blinded histologist.
Mitochondrial ETC activities TOP
All tissue samples were stored at -80 °C. Frozen skeletal muscle samples were thawed immediately prior to analysis and homogenates prepared using cholate. ETC activities were measured using CLIA validated methods and were performed at the CIDEM laboratory (Case Western Reserve University, Cleveland, Ohio) which has a wide experience of more than a decade in performance of ETC and other mitochondrial assays [17-20].
Measurements of NADH cytochrome c reductase (NCR) reflecting activities of complex I and III, NADH ferricyanide reductase (first three subunits of complex I), succinate cytochrome c reductase (complex II and III), succinate dehydrogenase, decylubiquinol cytochrome c reductase (complex III), cytochrome c oxidase (complex IV), and citrate synthase (marker of mitochondrial mass) were performed. In our laboratory, ETC activities determined by using frozen skeletal muscle were equivalent to those using fresh tissues (C. Hoppel, personal communication)
Cytokine expression levels in fat tissues
Levels of interleukin (IL)-1 (α and β), IL-2, IL-4, IL-5, IL8, IL-10, IL-12 (p35 and p40), IL-15, interferon-γ and tumor necrosis factor (TNF)-α RNA expression were measured at baseline and week 48. Total RNA was extracted from 25 mg of adipose tissue using the RNeasy Mini Kit (Qiagen) and DNA removed using on-column DNase digestion with the RNase-Free DNase Set (Qiagen). cDNA was generated from 2 μg RNA from subject samples and a normal control provided using the High-Capacity cDNA Archive Kit (Applied Biosystems). Five-hundred nanograms cDNA was used in each reaction well of the TaqMan Cytokine Gene Expression Plate I (Applied Biosystems). Samples were done in duplicate for each of the 12 cytokines and a normal human cDNA calibrator was used in each plate. Real-time PCR was performed on the ABI 7900 and results analyzed on the Sequence Detection Software v1.7.
Statistical analysis
The Wilcoxon signed-rank test was used to test whether the change from baseline to week 48 was different from zero for the adipose tissue, muscle, and PBMC data. The 95% confidence intervals (CI) were calculated for the mean mtDNA levels using the normal approximation. Interquartile ranges were also calculated for the mtDNA and apoptosis results. These analyses were not adjusted for multiple comparisons due to the small sample size and the descriptive nature of the analyses.
|
|
| |
| |
|
|
|