| |
Early antiretroviral treatment prevents the development of central nervous system abnormalities in simian immunodeficiency virus-infected rhesus monkeys
|
| |
| |
AIDS: 19 June 2009 - Volume 23 - Issue 10 - p 1187-1195
Marcondes, Maria Cecilia G; Flynn, Claudia; Huitron-Rezendiz, Salvador; Watry, Debbie D; Zandonatti, Michelle; Fox, Howard S
aDepartment of Molecular and Integrative Neurosciences, The Scripps Research Institute, La Jolla, California, USA
bDepartment of Pharmacology and Experimental Neuroscience, University of Nebraska Medical Center, Omaha, Nebraska, USA.
"treatment leads to a significant reduction in the viral load in the brain.....likely due to immune control [because ARTs used are not known to enter the CNS]....either due to a lower level of continued infection of the brain from peripheral virus, which itself is markedly diminished, or more effective immune control of the virus within the brain.....there was an overall enrichment of effector CD4 cells and decline in CD8 TCM. Such a shift in phenotype argues for increased active immune control of virus in the brain or for less killing of target cells.....avoid damage to neuronal components.......the enrichment of effector memory caused by early antiretroviral treatment resembles the phenotype observed in live-attenuated vaccination protocols [29], suggesting the potential of development of a long-lasting protective environment and priming by reducing the initial set point viral load."....."CCL5 is increased in the brains of treated animals...... CCL5 treatment of microglia was found to reduce their expression of the proinflammatory molecules, thus might act in protecting neurons from their deleterious effects [49]."
"Using an antiretroviral treatment regimen considered clinically to have low CNS efficacy, instituted in SIV-infected animals following the resolution of the acute viremic stage, we confirmed and expanded upon our prior results that a reduction of plasma viral load induced by the therapy is beneficial for preventing/treating CNS dysfunction"...."treatment induces an alteration in the memory phenotypes in the brain as well as a peripheral organ, the liver. Finally, alterations of the host transcriptional response to infection occur, with a decrease in IFN-α and the IFN-responsive G1P3 and an increase in CCL5"...."Our studies and those of others reveal that virus enters the brain early and is easily detectable by the second week after inoculation"
"Overall, our results reveal the significance of early treatment, even with antiretroviral agents that do not penetrate the BBB. Early administration of antiretrovirals is effective in lowering virus in the brain as well as preventing early signs of CNS dysfunction. Whether such early treatment will be effective in preventing the development of HAND is not known. However, a later introduction of antiretrovirals may not have such a beneficial effect, given the chronicity of virus-host interaction and its resulting effects in the brain. The effect of early treatment on the development of CNS disorders is worthy of study, as both early as well as chronic changes in the brain, including levels of virus and cytokines, can have a profound impact over the course of infection and overall patient prognosis."
"With the treatment-induced longer life expectancy, the prevalence of central nervous system (CNS) complications has risen in comparison with other AIDS-related complications, and as a whole, is either unchanged or possibly increasing..... Neurophysiological testing has revealed that changes in CNS function are detectable early after infection [12,13]. This is attributed to the early presence of the virus in the CNS, triggering events that can lead to neuronal damage......we report here studies on two groups of SIV-infected animals - one receiving combination antiretroviral therapy (the reverse transcriptase inhibitor tenofovir as well as the protease inhibitor nelfinavir) and the other receiving placebo as a control. Neither of these agents are clinically considered efficacious in the CNS......Animals were inoculated with simian immunodeficiency virus, and upon resolution of the acute infection period divided into two groups and treated, or not, with combination antiretroviral therapy......in all four of the antiretroviral-treated animals, the CSF viral load dropped below the limit of detection following treatment compared with just one of the four control animals......The treatment was initiated at 8 weeks after SIV inoculation and lasted until termination.....After infection, the motor activity began to decrease but returned to baseline following treatment (Fig. 1c). Although technical problems prevented the analysis of motor activity in the control group, we consistently observe a significant decline in motor activity following infection....Antiretroviral treatment alters memory T cells in the brain of infected monkeys [effector memory T-cell (TEM)]
Abstract
Objective: Neurocognitive disorders are devastating consequences of HIV infection. Although antiretroviral regimens have been efficacious in both improving life expectancy and decreasing dementia, there has not been an effect on the overall prevalence of HIV-associated neurocognitive disorders. Whether early institution of treatment, or treatment with drugs that effectively penetrate the blood-brain barrier, would help protect from such conditions is not known. Using the simian immunodeficiency virus/macaque model, we investigated the hypothesis that early introduction of antiretroviral treatment can protect the brain.
Design and methods: Animals were inoculated with simian immunodeficiency virus, and upon resolution of the acute infection period divided into two groups and treated, or not, with combination antiretroviral therapy. Viral, immune, and physiological parameters were measured during the course of infection, followed by assessment of viral, immune, and molecular parameters in the brain.
Results: We observed that even with agents that show poor penetration into the central nervous system, early antiretroviral treatment prevented characteristic neurophysiological and locomotor alterations arising after infection and resulted in a significant decrease in brain viral load. Although the number of infiltrating immune cells in the brain did not change with treatment, their phenotype did, favoring an enrichment of effector T cells. Early treatment also significantly lowered brain levels of interferon-α, a cytokine that can lead to neurocognitive and behavioral alterations.
Conclusion: Early antiretroviral treatment prevents central nervous system dysfunction by decreasing brain viral load and interferon-α levels, which can have a profound impact over the course of infection.
Introduction
A high proportion of HIV-1-infected individuals develop alterations in neurocognition (referred to as HIV-associated neurocognitive disorders; HAND), which are most prominent at later phases of infection. In the current era of HAART, the incidence of the severe form, HIV-1-associated dementia (HAD) has decreased [1]; however, other, less severe conditions persist. With the treatment-induced longer life expectancy, the prevalence of central nervous system (CNS) complications has risen in comparison with other AIDS-related complications, and as a whole, is either unchanged or possibly increasing [2-6]. There are many proposed reasons for this such as viral mutation, failure of therapy, CNS immunopathology due to the virus-host interaction, and/or lack of blood-brain barrier (BBB) penetration of therapy. Although the role of brain-penetrating antiretroviral agents in general HIV therapy is not clear, it has been found that the use of drugs thought to have higher CNS penetration or activity are associated with lower cerebrospinal fluid (CSF) viral loads [7,8].
Although the exact mechanism of HAND is not known, HIV infection of the CNS clearly initiates the disease. Macrophages and microglia are the only productively infected cells in the CNS, and thus, an indirect neurotoxic effect has been suggested [9]. Viral proteins, products of infected and/or activated microglia and macrophages, intrathecal immunoactivation, accumulation, and persistency of immune cells in the brain parenchyma, are probably also part of the pathogenesis and neurodegenerative process.
Simian immunodeficiency virus (SIV) infection in rhesus macaques reproduces all aspects of human infection with HIV, including the development of neurocognitive disorders [10,11]. Neurophysiological testing has revealed that changes in CNS function are detectable early after infection [12,13]. This is attributed to the early presence of the virus in the CNS, triggering events that can lead to neuronal damage. Among the alterations in the brain tissue in the SIV model, infiltrating immune cells, predominantly CD8+ T cells, are detectable early after infection and persist within the CNS [13]. These accumulating CD8 cells are in a highly activated state, based on the expression of surface activation markers and transcription of cytolytic and proinflammatory cytokines, and a high proportion of them are specific to the virus [14].
In addition to neurophysiological changes, we have found that SIV infection results in changes in the regulation of temperature and movement as well as alterations in cognitive and motor function [15-17]. To examine the role of treatment in the reversal of early identifiable changes in CNS function, we had previously examined the effects of antiretroviral therapy using monotherapy with 9-[2-(R)-(phosphonomethoxy) propyl]adenine (PMPA, tenofovir). This treatment (which was instituted following the identification of such abnormalities) was indeed able to reverse neurophysiological abnormalities, and following cessation of treatment, they returned [12]. However, the general decrease in locomotor activity was not responsive to this regimen.
Yet, little is known about the HIV or SIV-infected brain in the setting of antiretroviral therapy. Indeed, where infected individuals have access to such treatment, this is the most common state of the CNS in HIV infection. In order to address the effects of antiretroviral therapy on the brain, we report here studies on two groups of SIV-infected animals - one receiving combination antiretroviral therapy (the reverse transcriptase inhibitor tenofovir as well as the protease inhibitor nelfinavir) and the other receiving placebo as a control. Neither of these agents are clinically considered efficacious in the CNS [7,8,18]. Although our earlier study [12] examined the brains after cessation of monotherapy, here, animals were sacrificed while on active combination therapy (or placebo) to assess changes in the brain environment during treatment.
Results
Antiretroviral treatment ameliorates sensory-evoked potential abnormality and decreases brain viral load
Plasma viral load dropped as a result of the treatment in all four treated animals as compared to both pretreatment levels of viremia and to those found in the control animals that received placebo, throughout the treatment, and until termination (Fig. 1a). In three of the treated animals, the plasma viral load dropped to below the limit of detection, whereas the fourth reached levels near the limit of detection. Although CSF was not sampled as frequently as blood, in all four of the antiretroviral-treated animals, the CSF viral load dropped below the limit of detection following treatment compared with just one of the four control animals.
Changes in viral load did not correlate with changes on the relative or absolute numbers of either CD4 or CD8 T cells (data not shown) in the blood, and such T-cell numbers did not differ significantly between the groups. The treatment regimen did prevent the neurophysiological changes induced by infection, measured as a delay in late wave (P5) of the BSAEP (Fig. 1b). After infection, the motor activity began to decrease but returned to baseline following treatment (Fig. 1c). Although technical problems prevented the analysis of motor activity in the control group, we consistently observe a significant decline in motor activity following infection[12,17].
Following sacrifice, viral and immune parameters were analyzed in the brain. Treatment was successful in lowering the viral load in the brain (Fig. 2a). Although the amount of virus was reduced, the number of brain infiltrating CD8+ T cells, which were close to four-fold higher than in uninfected animals, did not differ between groups (13 482 ± 4822 CD8+ cells/uninfected brain; 37 196 ± 3361 CD8+ cells/placebo-treated brain; and 34 683 ± 10 990 CD8+ cells/antiretroviral-treated brain) (Fig. 2b). Similarly, the numbers of CD4 T cells, CD3-CD8+ natural killer (NK) cells, or CD11b+ cells (microglia and macrophages) in infected brains were similar to the numbers found in uninfected animals for these populations (not shown), and there was no difference in placebo versus antiretroviral-treated animals.
Antiretroviral treatment alters memory T cells in the brain of infected monkeys
In order to assess whether treatment led to differences in immune cell phenotypes, several surface markers that can be altered by cellular activation were evaluated on CD4 and CD8 T cells from the brain, CSF, blood, spleen, and liver. The percentage of CD11a-expressing T cells in infected animals was consistently higher than in uninfected controls (not shown), did not distinguish between infected groups subjected or not to antiretroviral treatment, either in blood, spleen, liver, or in the brain (not shown). However, in the CSF, CD8 cells expressing high levels of CD11a were more abundant in placebo-treated animals (84.8 ± 18.4% CD8 T cells) than in antiretroviral-treated animals (48.6 ± 8.2%) (P = 0.016, Student's t-test). Neither chemokine receptor 5 (CCR5) and CD25 [IL-2 receptor (IL-2R)] nor CD122 (IL-15R) was significantly altered by treatment in any of these sites (not shown).
In addition to these T-cell activation markers, we also investigated whether the antiretroviral treatment alters the memory phenotype or the distribution of memory cells. Overall, we observed that surface molecules, which correlate with the memory status, were able to distinguish groups, especially within the CD4 compartment. CD95 expression identifies memory T cells in monkeys [23,24]. We further divided CD95+ cells for the expression of CCR7. The down-modulation of this marker within the CD95+ fraction correlates with the development of an effector memory phenotype [effector memory T-cell (TEM)], whereas cells that remain CCR7+ play a central memory role [central memory T-cell (TCM)]. The expression of CCR7, within the CD95+ fraction, was significantly different among CD4 cells in the two nonlymphoid organs, the liver and the brain, between the groups (Table 1). In the animals that received antiretrovirals, there is an increase of TEM (cells with lower CCR7 expression) at the expense of TCM (high CCR7 expression) phenotype compared with placebo-treated animals (P = 0.016 and P = 0.005 for brain and liver, respectively, Student's t-test). In the CD8 compartment, the proportion of CCR7-expressing cells within CD95+ cells also changed in the brain with the antiretroviral treatment, with again a lower percentage of CCR7+ cells indicating a higher proportion of TEM (and lower TCM) CD8+ cells (Table 1). The spleen had more CCR7+ cells within the CD95+ compartment, indicating a higher percentage of TCM (and thus lower TEM) CD8+ cells upon treatment in that organ.
Thus, the T-cell proportions are altered in the organs of SIV-infected antiretroviral-treated animals compared with those animals that are infected but not treated. Specifically, in the brains of SIV-infected animals, the antiretroviral treatment resulted in a change both in the CD4 and CD8 T-cell compartments characterized by an increase in TEM.
Discussion
Using an antiretroviral treatment regimen considered clinically to have low CNS efficacy, instituted in SIV-infected animals following the resolution of the acute viremic stage, we confirmed and expanded upon our prior results that a reduction of plasma viral load induced by the therapy is beneficial for preventing/treating CNS dysfunction. Here, modeling an early commencement of treatment, for example after an individual is exposed, develops an acute viremic syndrome, is recognized as infected and begins therapy, we find thattreatment leads to a significant reduction in the viral load in the brain. Although the magnitude of the infiltrating immune cells into the brain is unchanged, treatment induces an alteration in the memory phenotypes in the brain as well as a peripheral organ, the liver. Finally, alterations of the host transcriptional response to infection occur, with a decrease in IFN-α and the IFN-responsive G1P3 and an increase in CCL5.
Our studies and those of others reveal that virus enters the brain early and is easily detectable by the second week after inoculation[25-27]. The RNA viral load then drops in the brain as it does outside of the brain likely due to immune control. The decrease in viral load in the brain that we observed following treatment is likely either due to a lower level of continued infection of the brain from peripheral virus, which itself is markedly diminished, or more effective immune control of the virus within the brain. The overall number of infiltrating immune cells is unchanged by antiretroviral treatment in the infected brain. However, there was an overall enrichment of effector CD4 cells and decline in CD8 TCM. Such a shift in phenotype argues for increased active immune control of virus in the brain or for less killing of target cells. Although we did not quantify the percentage of virus-specific cells, the shifting to an effector phenotype, correlating with a successful decrease of viral load, may contribute to the generation of a more focused response, with less bystander activity, which may be rather beneficial both to control the virus and avoid damage to neuronal components.
Other studies [28] have found that monkeys with chronic SIV infection and treated with antiretrovirals showed changes in the distribution of the memory phenotype within SIV-specific cytotoxic T lymphocytes (CTL) in the blood from TEM to TCM. We did not see such a shift in blood, possibly due to the earlier institution of treatment as well as our examination of bulk CD8 T cells as opposed to viral epitope-specific CTL. In any regard, in the brain, we found the opposite in both CD4 and CD8 T cells, with a shift from TCM to TEM. This shift may represent changes in the brain CD8 population that favor more effective immune control of virus, resulting in the lowered brain viral load. However, the antiretroviral drugs may reduce the brain viral load by controlling virus peripherally. This can result in lowered infection and killing of active TEM cells, thus increasing their frequency. Regardless of the mechanism, the enrichment of effector memory caused by early antiretroviral treatment resembles the phenotype observed in live-attenuated vaccination protocols [29], suggesting the potential of development of a long-lasting protective environment and priming by reducing the initial set point viral load.
Treatment, and the subsequent lowering of brain and blood virus, resulted in a significant decrease of IFN-α in the infected brain.This finding is a potential key for the amelioration of CNS dysfunction, manifested in HIV infection as cognitive and motor symptoms and in our experiments as abnormal delay in sensory-evoked potentials. Although we cannot exclude a direct effect from the drugs themselves, this is correlated with the decrease of infected cells in the CNS. Increased IFN-α in the basal ganglia in patients has been shown to contribute to neurological and behavioral changes [30-35]. Patients with HIV dementia have high levels of IFN-α in the CSF [36,37]. Also, in a mouse model of neuroAIDS, in which HIV-infected macrophages are intracerebrally injected in severe combined immunodeficiency (SCID) mice, cognitive dysfunction correlates with the expression of IFN-α on neurons and glial cells [38,39]. Interestingly, IFN-α treatment is used therapeutically in some viral infections and cancer, but such treatment often results in neurological deficits and behavioral alterations [40-44], strongly suggesting a direct correlation between levels of this cytokine and CNS dysfunction.
IFN-α can also influence the local T-cell response. It supports an effector phenotype on T cells, but by transiently increasing apoptosis also contributes to the elimination of activated cells [45]. In addition, similar to IL-15, IFN-α can support the division of memory cells in an antigen-independent way, facilitating the enrichment of bystander cells [46,47]. However, whether there is a linkage between the reduction in IFN-α and the changes found in T-cell phenotypes in the brain is not known.
In contrast to the decrease in IFN-α, CCL5 is increased in the brains of treated animals. Whether this increase found with treatment may result from, or possibly contribute to, the difference in T-cell memory phenotype is not known. In addition to its chemokine properties, CCL5 is among the soluble inhibitory factors with the ability to inhibit HIV-1 infection and spread [48], and thus may contribute to the reduction in brain viral load. Furthermore, CCL5 treatment of microglia was found to reduce their expression of the proinflammatory molecules, thus might act in protecting neurons from their deleterious effects [49].
Interestingly, the inflammatory mediator profiling revealed that, irrespective of treatment, higher levels of their mRNAs could be found in the hippocampus as opposed to other brain regions. Certainly, region-specific gene expression occurs in the primate brain [50], but whether this contributes to these region-specific differences found in the infected brain is unknown. However, it has been found that hippocampal microglia, compared with microglia from other regions of the brain, express higher levels of some inflammatory mediators [51]. Our findings may reflect such increased proclivity of hippocampal microglia to express inflammatory molecules.
Overall, our results reveal the significance of early treatment, even with antiretroviral agents that do not penetrate the BBB. Early administration of antiretrovirals is effective in lowering virus in the brain as well as preventing early signs of CNS dysfunction. Whether such early treatment will be effective in preventing the development of HAND is not known. However, a later introduction of antiretrovirals may not have such a beneficial effect, given the chronicity of virus-host interaction and its resulting effects in the brain. The effect of early treatment on the development of CNS disorders is worthy of study, as both early as well as chronic changes in the brain, including levels of virus and cytokines, can have a profound impact over the course of infection and overall patient prognosis.
Methods
Animals
Rhesus monkeys, free from SIV, type D simian retrovirus, and herpes B virus, were obtained from Covance (Alice, Texas, USA) and Charles River (Key Lois, Florida, USA). All animal experiments were performed with approval from the Scripps Institutional Animal Care and Use Committee and followed National Institutes of Health (NIH) guidelines. Blood samples were drawn from the femoral vein from animals under ketamine anesthesia, and plasma was separated by centrifugation from cells in EDTA-anticoagulated blood. CSF was obtained from the cisterna magna. CSF samples containing more than 0.1% blood contamination [determined by red blood cell (RBC) counts] were discarded. Necropsy was performed after terminal anesthesia. During necropsy, animals were perfused intracardially with sterile PBS containing 1 U/ml heparin before tissue samples were taken for cell isolation, virus quantification, and formalin fixation for histology.
Radiotelemetry
Body temperature and gross locomotor activity were measured by means of radiotelemetry implants, placed while the animals were under isoflurane anesthesia, with postoperative analgesia with buprenorphine. Signals from individually implanted telemetry transmitters (Physiotel TA10TA-D70; Data Sciences International, St. Paul, Minnesota, USA) were received by individual receivers (model RMC-1; Data Sciences International), which were connected to the data acquisition matrix, and the data were processed using Dataquest ART 4.0 software (Data Sciences International). Temperature and activity were continuously monitored before and after infection. The values used for this study correspond to the average of 12-h daytime recording periods.
Viral infection
A cell-free stock of SIV (derived from SIVmac251) obtained after serial passage of SIV-infected microglia was the inoculum used [19]. Animals received 0.25 ml of the stock, diluted into Roswell Park Memorial Institute (RPMI)-1640 (Invitrogen, Carlsbad, California, USA) for intravenous injection, containing 5 ng/ml of p27 (gag) antigen.
Antiviral treatment
Antiretroviral-treated animals received one daily intramuscular injection of tenofovir (Gilead, Foster City, California, USA), 30 mg/kg in phosphate-buffered physiological saline, at 1130 h, and nelfinavir mesylate (Pfizer, New York, New York, USA) was administered orally at 20 mg/kg in banana-flavored primate tablets (Bio-Serve, Frenchtown, New Jersey, USA), twice a day, at 0600 and at 1600 h. The treatment was initiated at 8 weeks after SIV inoculation and lasted until termination. Animals with numbers 422, 424, 492, and 495 were treated with placebo (placebo injections and pills), whereas animals with numbers 425, 431, 433, and 498 received the active agents. All animals were sacrificed between 15 and 16 weeks after SIV inoculation while still receiving the treatment per experimental protocol.
Viral quantitation
To measure viral load, SIV RNA in plasma, CSF, and brain tissue, quantitative branched DNA signal amplification assay was performed by Siemens Reference Testing Laboratory (Emeryville, California, USA). Each sample was measured in duplicate and reported as average value.
Electrophysiology
Electrophysiological analysis of brainstem auditory evoked potential (BSAEP) was performed on ketamine (20 mg/kg)-anesthetized animals as described previously [20]. Averaged peak latencies were calculated and compared between group means.
Peripheral mononuclear cells
Buffy coats obtained from centrifugation of EDTA-anticoagulated blood, and cell suspensions from spleen, deep cervical, and inguinal lymph nodes, passed through a nylon mesh, were submitted to a Ficoll-isopaque (Pharmacia Biotech, Uppsala, Sweden) gradient centrifugation for isolation of the mononuclear fraction. After washing, cells were enumerated in a Coulter Z2 (Coulter Co., Miami, Florida, USA) and resuspended in complete RPMI-1640, containing 10% fetal calf serum (FCS) at a concentration of 107/ml, for labeling or cryopreservation.
Brain cells
The meninges were carefully removed and the brain mechanically and enzymatically disassociated, and immune cells purified on a Percoll gradient (Pharmacia Biotech) as previously described [13] and quantified in a Coulter Z2.
Flow cytometry
Cells isolated as described (2 x 105-10 x 105) were stained with 50 µl mixtures of antibodies diluted according to a previous titration in staining buffer [Hank's buffered salt solution (HBSS; Life Technologies Inc., Gaithersburg, Maryland, USA) with 2% FCS and 0.01% sodium azide (NaN3)]. The antibodies used for the staining were antimonkey CD3-biotin (clone FN-18; Biosource International, Camarillo, California, USA) followed by streptavidin-allophycocyanin (APC) (Pharmingen, San Diego, California, USA), antihuman CD8-phycoerythrin (CD8-PE) (clone DK25; Dako, Glostrup, Denmark), anti-CD11a-fluorescein isothiocyanate (FITC) (clone 25.3.1; Immunotech, Westbrook, Maine, USA), anti-CD45RA (clone 5H9; BD Pharmingen, San Diego, California, USA), anti-Mac-1-phycoerythrin (anti-Mac-1-PE) [clone M1/70(9); Boehringer Mannheim, Indianapolis, Indiana, USA], anti-CD95 (clone DX2; BD Pharmingen), and anti-CD4-phycoerythrin (anti-CD4-PE) [clone OKT4 (Ortho Diagnostics, Raritan, New Jersey, USA) hybridoma obtained from the ATCC, with the secreted antibody purified and phycoerythrin conjugated in the laboratory]. Isotype controls (BD Pharmingen) were also applied. The cells were acquired through a FacsCalibur (Becton-Dickinson, Franklin Lakes, New Jersey, USA) before analysis of data in CellQuest software (Becton-Dickinson Immunocytometry Systems, San Jose, California, USA).
Real time PCR
For RNA extraction, total RNA was purified from samples using TRIzol reagent (Invitrogen, Carlsbad, California, USA) following the protocol of the manufacturer, with an additional centrifugation step to remove cellular debris. RNA was further purified (RNeasy mini kit; Qiagen, Valencia, California, USA) and quantified by 260 nm ultraviolet (UV) absorption. Specific RNA transcripts were quantified using real-time PCR. The primers and probe sequences for ß-2-microglobulin (ß2M), chemokine ligand 5 (CCL5), G1P3, human leukocyte antigen (HLA)-DRα, interleukin (IL)-15, IL-1ß, and tumor necrosis factor-α (TNFα), and the control genes 18S, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and TATA box-binding protein (TBP) were designed for rhesus macaque sequences and were previously reported [14,21,22]. The primers and probe sequences for interferon-α (IFN-α) were homologous to rhesus IFN-α2 and were: (forward primer) GCCTGAAGGACAGACATGACTTT, (reverse primer) GGATGGTTTGAGCCTTTTGG, (FAM/TAMRA-labeled probe) CCCCAGGAGGAGTTTGGCAACCA. Relative amounts of each cytokine mRNA in the samples was obtained upon normalization of the average cycle threshold (Ct) against the average of the three control genes. Reactions were performed in a Stratagene MX30000 (Stratagene, La Jolla, California, USA).
Statistical analysis
Statistical analysis was done using Student's t-test or analysis of variance (ANOVA), followed by a posttest when appropriate. Alpha was set at 0.05 for determination of significance. The tests were performed using Microsoft Excel X for Mac or Prism version 4.0 for Mac (GraphPad Software, La Jolla, California, USA).
References
1. Maschke M, Kastrup O, Esser S, Ross B, Hengge U, Hufnagel A. Incidence and prevalence of neurological disorders associated with HIV since the introduction of highly active antiretroviral therapy (HAART). J Neurol Neurosurg Psychiatry 2000; 69:376-380.
2. Sacktor N, McDermott MP, Marder K, Schifitto G, Selnes OA, McArthur JC, et al. HIV-associated cognitive impairment before and after the advent of combination therapy. J Neurovirol 2002; 8:136-142.
3. Dore GJ, Correll PK, Li Y, Kaldor JM, Cooper DA, Brew BJ. Changes to AIDS dementia complex in the era of highly active antiretroviral therapy. AIDS 1999; 13:1249-1253.
4. Dore GJ, McDonald A, Li Y, Kaldor JM, Brew BJ. Marked improvement in survival following AIDS dementia complex in the era of highly active antiretroviral therapy. AIDS 2003; 17:1539-1545.
5. Boisse L, Gill MJ, Power C. HIV infection of the central nervous system: clinical features and neuropathogenesis. Neurol Clin 2008; 26:799-819.
6. Antinori A, Arendt G, Becker JT, Brew BJ, Byrd DA, Cherner M, et al. Updated research nosology for HIV-associated neurocognitive disorders. Neurology 2007; 69:1789-1799.
7. Letendre S, Marquie-Beck J, Capparelli E, Best B, Clifford D, Collier AC, et al. Validation of the CNS penetration-effectiveness rank for quantifying antiretroviral penetration into the central nervous system. Arch Neurol 2008; 65:65-70.
8. Letendre SL, McCutchan JA, Childers ME, Woods SP, Lazzaretto D, Heaton RK, et al. Enhancing antiretroviral therapy for human immunodeficiency virus cognitive disorders. Ann Neurol 2004; 56:416-423.
9. Gonzalez-Scarano F, Martin-Garcia J. The neuropathogenesis of AIDS. Nat Rev Immunol 2005; 5:69-81.
10. Fox HS. Virus-host interaction in the simian immunodeficiency virus-infected brain. J Neurovirol 2008; 14:286-291.
11. Burudi EM, Fox HS. Simian immunodeficiency virus model of HIV-induced central nervous system dysfunction. Adv Virus Res 2001; 56:435-468.
12. Fox HS, Weed MR, Huitron-Resendiz S, Baig J, Horn TF, Dailey PJ, et al. Antiviral treatment normalizes neurophysiological but not movement abnormalities in simian immunodeficiency virus-infected monkeys. J Clin Invest 2000; 106:37-45.
13. Marcondes MC, Burudi EM, Huitron-Resendiz S, Sanchez-Alavez M, Watry D, Zandonatti M, et al. Highly activated CD8(+) T cells in the brain correlate with early central nervous system dysfunction in simian immunodeficiency virus infection. J Immunol 2001; 167:5429-5438.
14. Marcondes MC, Burdo TH, Sopper S, Huitron-Resendiz S, Lanigan C, Watry D, et al. Enrichment and persistence of virus-specific CTL in the brain of simian immunodeficiency virus-infected monkeys is associated with a unique cytokine environment. J Immunol 2007; 178:5812-5819.
15. Huitron-Resendiz S, Marcondes MC, Flynn CT, Lanigan CM, Fox HS. Effects of simian immunodeficiency virus on the circadian rhythms of body temperature and gross locomotor activity. Proc Natl Acad Sci U S A 2007; 104:15138-15143.
16. Gold LH, Fox HS, Henriksen SJ, Buchmeier MJ, Weed MR, Taffe MA, et al. Longitudinal analysis of behavioral, neurophysiological, viral and immunological effects of SIV infection in rhesus monkeys. J Med Primatol 1998; 27:104-112.
17. Horn TF, Huitron-Resendiz S, Weed MR, Henriksen SJ, Fox HS. Early physiological abnormalities after simian immunodeficiency virus infection. Proc Natl Acad Sci U S A 1998; 95:15072-15077.
18. Varatharajan L, Thomas SA. The transport of anti-HIV drugs across blood-CNS interfaces: summary of current knowledge and recommendations for further research. Antiviral Res 2009 [Epub ahead of print]
19. Watry D, Lane TE, Streb M, Fox HS. Transfer of neuropathogenic simian immunodeficiency virus with naturally infected microglia. Am J Pathol 1995; 146:914-923.
20. Prospero-Garcia O, Gold LH, Fox HS, Polis I, Koob GF, Bloom FE, Henriksen SJ. Microglia-passaged simian immunodeficiency virus induces neurophysiological abnormalities in monkeys. Proc Natl Acad Sci U S A 1996; 93:14158-14163.
21. Roberts ES, Huitron-Resendiz S, Taffe MA, Marcondes MC, Flynn CT, Lanigan CM, et al. Host response and dysfunction in the CNS during chronic simian immunodeficiency virus infection. J Neurosci 2006; 26:4577-4585.
22. Burudi EM, Marcondes MC, Watry DD, Zandonatti M, Taffe MA, Fox HS. Regulation of indoleamine 2,3-dioxygenase expression in simian immunodeficiency virus-infected monkey brains. J Virol 2002; 76:12233-12241.
23. Pitcher CJ, Hagen SI, Walker JM, Lum R, Mitchell BL, Maino VC, et al. Development and homeostasis of T cell memory in rhesus macaque. J Immunol 2002; 168:29-43.
24. Marcondes MC, Penedo MC, Lanigan C, Hall D, Watry DD, Zandonatti M, Fox HS. Simian immunodeficiency virus-induced CD4+ T cell deficits in cytokine secretion profile are dependent on monkey origin. Viral Immunol 2006; 19:679-689.
25. Chakrabarti L, Hurtrel M, Maire MA, Vazeux R, Dormont D, Montagnier L, Hurtrel B. Early viral replication in the brain of SIV-infected rhesus monkeys. Am J Pathol 1991; 139:1273-1280.
26. Lane JH, Sasseville VG, Smith MO, Vogel P, Pauley DR, Heyes MP, Lackner AA. Neuroinvasion by simian immunodeficiency virus coincides with increased numbers of perivascular macrophages/microglia and intrathecal immune activation. J Neurovirol 1996; 2:423-432.
27. Roberts ES, Burudi EM, Flynn C, Madden LJ, Roinick KL, Watry DD, et al. Acute SIV infection of the brain leads to upregulation of IL6 and interferon-regulated genes: expression patterns throughout disease progression and impact on neuroAIDS. J Neuroimmunol 2004; 157:81-92.
28. Mueller YM, Petrovas C, Do DH, Altork SR, Fischer-Smith T, Rappaport J, et al. Early establishment and antigen dependence of simian immunodeficiency virus-specific CD8+ T-cell defects. J Virol 2007; 81:10861-10868.
29. Rollman E, Smith MZ, Brooks AG, Purcell DF, Zuber B, Ramshaw IA, Kent SJ. Killing kinetics of simian immunodeficiency virus-specific CD8+ T cells: implications for HIV vaccine strategies. J Immunol 2007; 179:4571-4579.
30. Majer M, Welberg LA, Capuron L, Pagnoni G, Raison CL, Miller AH. IFN-alpha-induced motor slowing is associated with increased depression and fatigue in patients with chronic hepatitis C. Brain Behav Immun 2008; 22:870-880.
31. Raison CL, Borisov AS, Broadwell SD, Capuron L, Woolwine BJ, Jacobson IM, et al. Depression during pegylated interferon-alpha plus ribavirin therapy: prevalence and prediction. J Clin Psychiatry 2005; 66:41-48.
32. Raison CL, Borisov AS, Woolwine BJ, Massung B, Vogt G, Miller AH. Interferon-alpha effects on diurnal hypothalamic-pituitary-adrenal axis activity: relationship with proinflammatory cytokines and behavior. Mol Psychiatry 2008. [Epub ahead of print]
33. Raison CL, Broadwell SD, Borisov AS, Manatunga AK, Capuron L, Woolwine BJ, et al. Depressive symptoms and viral clearance in patients receiving interferon-alpha and ribavirin for hepatitis C. Brain Behav Immun 2005; 19:23-27.
34. Raison CL, Demetrashvili M, Capuron L, Miller AH. Neuropsychiatric adverse effects of interferon-alpha: recognition and management. CNS Drugs 2005; 19:105-123.
35. Yoshida K, Alagbe O, Wang X, Woolwine B, Thornbury M, Raison CL, Miller AH. Promoter polymorphisms of the interferon-alpha receptor gene and development of interferon-induced depressive symptoms in patients with chronic hepatitis C: preliminary findings. Neuropsychobiology 2005; 52:55-61.
36. Rho MB, Wesselingh S, Glass JD, McArthur JC, Choi S, Griffin J, Tyor WR. A potential role for interferon-alpha in the pathogenesis of HIV-associated dementia. Brain Behav Immun 1995; 9:366-377.
37. Perrella O, Carreiri PB, Perrella A, Sbreglia C, Gorga F, Guarnaccia D, Tarantino G. Transforming growth factor beta-1 and interferon-alpha in the AIDS dementia complex (ADC): possible relationship with cerebral viral load? Eur Cytokine Netw 2001; 12:51-55.
38. Sas A, Jones R, Tyor W. Intra-peritoneal injection of polyclonal antiinterferon alpha antibodies cross the blood brain barrier and neutralize interferon alpha. Neurochem Res 2008; 33:2281-2287.
39. Sas AR, Bimonte-Nelson HA, Tyor WR. Cognitive dysfunction in HIV encephalitic SCID mice correlates with levels of Interferon-alpha in the brain. AIDS 2007; 21:2151-2159.
40. Pavol MA, Meyers CA, Rexer JL, Valentine AD, Mattis PJ, Talpaz M. Pattern of neurobehavioral deficits associated with interferon alfa therapy for leukemia. Neurology 1995; 45:947-950.
41. Hauser P, Khosla J, Aurora H, Laurin J, Kling MA, Hill J, et al. A prospective study of the incidence and open-label treatment of interferon-induced major depressive disorder in patients with hepatitis C. Mol Psychiatry 2002; 7:942-947.
42. Hauser P, Soler R, Reed S, Kane R, Gulati M, Khosla J, et al. Prophylactic treatment of depression induced by interferon-alpha. Psychosomatics 2000; 41:439-441.
43. Scheibel RS, Valentine AD, O'Brien S, Meyers CA. Cognitive dysfunction and depression during treatment with interferon-alpha and chemotherapy. J Neuropsychiatry Clin Neurosci 2004; 16:185-191.
44. Valentine AD, Meyers CA, Kling MA, Richelson E, Hauser P. Mood and cognitive side effects of interferon-alpha therapy. Semin Oncol 1998; 25:39-47.
45. Kaser A, Enrich B, Ludwiczek O, Vogel W, Tilg H. Interferon-alpha (IFN-alpha) enhances cytotoxicity in healthy volunteers and chronic hepatitis C infection mainly by the perforin pathway. Clin Exp Immunol 1999; 118:71-77.
46. Bahl K, Kim SK, Calcagno C, Ghersi D, Puzone R, Celada F, et al. IFN-induced attrition of CD8 T cells in the presence or absence of cognate antigen during the early stages of viral infections. J Immunol 2006; 176:4284-4295.
47. McNally JM, Zarozinski CC, Lin MY, Brehm MA, Chen HD, Welsh RM. Attrition of bystander CD8 T cells during virus-induced T-cell and interferon responses. J Virol 2001; 75:5965-5976.
48. DeVico AL, Gallo RC. Control of HIV-1 infection by soluble factors of the immune response. Nat Rev Microbiol 2004; 2:401-413.
49. Gamo K, Kiryu-Seo S, Konishi H, Aoki S, Matsushima K, Wada K, Kiyama H. G-protein-coupled receptor screen reveals a role for chemokine receptor CCR5 in suppressing microglial neurotoxicity. J Neurosci 2008; 28:11980-11988.
50. Khaitovich P, Muetzel B, She X, Lachmann M, Hellmann I, Dietzsch J, et al. Regional patterns of gene expression in human and chimpanzee brains. Genome Res 2004; 14:1462-1473.
51. Ren L, Lubrich B, Biber K, Gebicke-Haerter PJ. Differential expression of inflammatory mediators in rat microglia cultured from different brain regions. Brain Res Mol Brain Res 1999; 65:198-205.
|
|
| |
| |
|
|
|
