| |
New Gene Therapy Zinc Fingers Research Published: 'doctors may someday control HIV virus using stem cells without using anti-retroviral drugs'
|
| |
| |
Scientists at the Keck School of Medicine at the University of Southern California conducted a study on rodents to test cells that target one of the two gateway molecules where the HIV virus uses to enter one's body. The spokeswoman for the team said that they modified the blood stem cells to make it resistant to the virus then they transplanted them to the rodents, after that the rodents can now control the infection, in what way?
People with "a mutation gene called CCR5 are naturally resistant to the HIV infection and does not develop AIDS, we used the enzymes to knock out the CCR5 gene in human blood stem cells then transplanted it to the rodents. The new cells will develop into mature cells of the human immune system including T cells that HIV infects. After infecting the rodents with the virus, they were able to maintain normal levels of T cells that can suppress HIV. By creating CCR5-deficient stem cells, we can allow a patient to produce HIV-restraint cells."
Now the next step for them is to try the research on humans; they hope that it'll work for us. If it works, patients don't need to take anti-retroviral medicines anymore all they have to do is undergo stem cell therapy to create HIV resistant immune cells that can kill the HIV viruses in their body.
"In summary, our data demonstrate that transient ZFN treatment of human CD34+ HSPCs can efficiently disrupt CCR5 while yielding cells that remain competent to engraft and support hematopoiesis. In the presence of CCR5-tropic HIV-1, CCR5-/- progeny rapidly replaced cells depleted by the virus, leading to a polyclonal population that ultimately preserved human immune cells in multiple tissues. Our findings indicate that the modification of only a minority of human CD34+ HSPCs may provide the same strong anti-viral benefit as was conferred by a complete CCR5Δ32 stem cell transplantation in a patient9. And they further suggest that a partially modified autologous transplant, administered under only mildly ablative transplantation regimens may also be effective, opening up the treatment to many more HIV-infected individuals. Finally, the identification of conditions that allow the efficient use of ZFNs in human CD34+ HSPCs suggests the use of this technology in other diseases for which HSPC modification may be curative."
Scientists Make Immune Cells in Mice That Fight Off HIV - pdf publication attached
Randy Dotinga
Fri Jul 2, 11:48 pm ET
FRIDAY, July 2 (HealthDay News) -- Research in mice suggests that scientists may have a new lead on using gene therapy against the virus that causes AIDS.
The researchers tinkered with human stem cells and then inserted them into mice where they multiplied into immune system cells that provided protection against infection with HIV, according to a study released online July 2 in Nature Biotechnology.
The results are unlike typical research in animals because the mice have been "humanized": They have human immune systems and resisted a human disease. Still, until research is conducted on humans, there's no way to know if the treatment will work in people. And it may be years until that happens.
But there are high hopes. "It's a one-shot treatment if it works," noted study co-author Paula Cannon, associate professor of molecular microbiology at the University of Southern California.
In gene therapy, doctors try to coax the human body into doing something differently by tweaking its genetic structure. To treat HIV, the virus that causes AIDS, scientists have been experimenting with using gene therapy to boost the immune system.
In the new study, researchers engineered human stem cells -- cells that create other cells -- to lock a kind of "door" that allows HIV to enter.
The door, a "receptor" on immune cells linked to a gene known as CCR5, is disabled in a very small percentage of people, and those people appear to be virtually immune to HIV.
"That's like nature telling us how to cure AIDS," Cannon reasoned. The idea of the experimental treatment is "to engineer a patient's own cells so they'd be resistant to HIV" in much the same way.
The researchers did this by "cutting" a gene in the stem cells. These genetically manipulated cells did try and repair the injury, Cannon noted, but they didn't do a good job and HIV's way in was essentially disabled.
The researchers inserted these tweaked stem cells into the humanized mice and other mice, then tried to infect them with HIV.
According to the scientists, the genetically engineered stem cells went on to create mature immune system cells, such as T-cells, in the humanized mice. After a couple of weeks, these new immune cells appeared to provide protection against HIV. The cells grew greatly in number, offering fewer targets for the virus to attack.
Meanwhile, the virus made its usual successful attack on other mice that had not undergone the procedure.
Rowena Johnston, vice president of research with the Foundation for AIDS Research (amfAR) in New York City, said gene therapy is starting to show "real promise," and this study reveals a new side of its potential.
"One of the doctrines of gene therapy in the context of HIV has been the assumption that every relevant cell must be transformed," she said. "This research demonstrates that need not be the case."
But could this approach work in humans? The answer to that is yet to come, Cannon said.
"We want to make sure that this works, and a good place to start is in a patient population who already have their stem cells taken out," she said. Cannon and her colleagues would like to test it by piggybacking on a gene therapy treatment in which the stem cells of HIV-positive lymphoma patients are removed, tinkered with and then put back into their bodies.
Cannon doesn't know how much the gene therapy will cost, but one estimate puts the expense of this type of treatment for HIV at $100,000. But if it allows HIV patients to avoid taking drugs for the rest of their lives, she said, it should be cost-effective over time.
Whatever the case, the treatment isn't around the bend. Cannon said it could be four years before research in humans can begin. But another treatment that uses a similar strategy on a type of immune cell is already being tested in people.
Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo
Nathalia Holt, Jianbin Wang, Kenneth Kim, Geoffrey Friedman, Xingchao Wang, Vanessa Taupin, Gay M Crooks, Donald B Kohn, Philip D Gregory, Michael C Holmes & Paula M Cannon
July 2 1010 advanced pub Nature Biotechnology
Abstract
CCR5 is the major HIV-1 co-receptor, and individuals homozygous for a 32-bp deletion in CCR5 are resistant to infection by CCR5-tropic HIV-1. Using engineered zinc-finger nucleases (ZFNs), we disrupted CCR5 in human CD34+ hematopoietic stem/progenitor cells (HSPCs) at a mean frequency of 17% of the total alleles in a population. This procedure produces both mono- and bi-allelically disrupted cells. ZFN-treated HSPCs retained the ability to engraft NOD/SCID/IL2rγnull mice and gave rise to polyclonal multi-lineage progeny in which CCR5 was permanently disrupted. Control mice receiving untreated HSPCs and challenged with CCR5-tropic HIV-1 showed profound CD4+ T-cell loss. In contrast, mice transplanted with ZFN-modified HSPCs underwent rapid selection for CCR5-/- cells, had significantly lower HIV-1 levels and preserved human cells throughout their tissues. The demonstration that a minority of CCR5-/- HSPCs can populate an infected animal with HIV-1-resistant, CCR5-/- progeny supports the use of ZFN-modified autologous hematopoietic stem cells as a clinical approach to treating HIV-1.
Introduction
The entry of HIV-1 into target cells involves sequential binding of the viral gp120 Env protein to the CD4 receptor and a chemokine co-receptor1. CCR5 is the major co-receptor used by HIV-1 and is expressed on key T-cell subsets that are depleted during HIV-1 infection, including memory T cells2. A genetic 32-bp deletion in CCR5 (CCR5Δ32) is relatively common in Western European populations and confers resistance to HIV-1 infection and AIDS in homozygotes3, 4. The absence of any other significant phenotype associated with a lack of CCR5 (refs. 5, 6, 7) has spurred the development of therapies aimed at blocking the virus-CCR5 interaction, and CCR5 antagonists have proved to be an effective salvage therapy in patients with drug-resistant strains of HIV-1 (ref. 8).
Recently, the ability of CCR5-/- mobilized CD34+ peripheral blood cells to generate HIV-resistant progeny that suppress HIV-1 replication in vivo was demonstrated in an HIV-infected patient undergoing transplantation from a homozygous CCR5Δ32 donor during treatment for acute myeloid leukemia9. The donor cells conferred long-term control of HIV-1 replication and restored the patient's CD4+ T-cell levels in the absence of antiretroviral drug therapy. These clinical data support the potential of gene or stem cell therapies based on the elimination of CCR5. However, the risks associated with allogeneic transplantation and the impracticality of obtaining sufficient numbers of matched CCR5Δ32 donors10 mean that broader application of this approach will require methods for generating autologous CCR5-/- cells. Various gene therapy approaches to block CCR5 expression are being evaluated, including CCR5-specific ribozymes11, 12, siRNAs13 and intrabodies14. The targeted cell populations include both mature T cells and CD34+ HSPCs. Loss of CCR5 in HSPCs appears to have no adverse effects on hematopoiesis12, 13, 15.
An alternative approach is the use of engineered ZFNs to permanently disrupt the CCR5 open reading frame. ZFNs comprise a series of linked zinc fingers engineered to bind specific DNA sequences and fused to an endonuclease domain16. Concerted binding of two juxtaposed ZFNs on DNA, followed by dimerization of the endonuclease domains, generates a double-stranded break at the DNA target. Such double-stranded breaks are rapidly repaired by cellular repair pathways, notably the mutagenic nonhomologous end-joining pathway, which leads to frequent disruption of the gene due to the addition or deletion of nucleotides at the break site17, 18. A significant advantage of this approach is that permanent gene disruption can result from only transient ZFN expression.
Click here to find out more!
CD4+ T cells modified by CCR5-targeted ZFNs19 are currently being evaluated in a clinical trial. However, disruption of CCR5 in HSPCs is likely to provide a more durable anti-viral effect and to give rise to CCR5-/- cells in both the lymphoid and myeloid compartments that HIV-1 infects. To evaluate this approach, we optimized the delivery of CCR5-specific ZFNs to human CD34+ HSPCs and transplanted the modified cells into nonobese diabetic/severe combined immunodeficient/interleukin 2rγnull (NOD/SCID/IL2rγnull; NSG) mice, which support both human hematopoiesis20 and HIV-1 infection13. Infection of the mice with a CCR5-tropic strain of HIV-1 led to rapid selection for CCR5- human cells, a significant reduction in viral load and protection of human T-cell populations in the key tissues that HIV-1 infects. These findings suggest that ZFN engineering of autologous HSPCs may enable long-term control of HIV-1 in infected individuals.
Discussion
Despite major advances in anti-retroviral therapy, HIV-1 infection remains an epidemic cause of morbidity and mortality. Effective anti-retroviral therapy often involves costly, multi-drug regimens that are not well tolerated by a significant percentage of patients42, and even successful adherence to the therapy does not eradicate the virus, and a rapid rebound in HIV-1 levels can occur if therapy is discontinued43. An alternative approach to controlling HIV-1 replication is engineering of the body's immune cells to be resistant to infection44. In this regard, the CCR5 co-receptor is an attractive target because of the HIV-resistant phenotype of homozygous CCR5Δ32 individuals3. In the present study, we identified conditions that allow efficient disruption of CCR5 in human CD34+ HSPCs and demonstrated that such modified cells generate CCR5-/-, HIV-resistant progeny in a mouse model of human hematopoiesis and HIV-1 infection, leading to control of HIV-1 replication. These findings suggest that transplantation of autologous HSPCs modified by CCR5-specific ZFNs may provide a permanent supply of HIV-resistant progeny that could replace cells killed by HIV-1, reconstitute the immune system and control viral replication long term in the absence of anti-retroviral therapy.
The high levels of CCR5 disruption that we achieved were possible because of an efficient gene editing technology based on ZFNs. ZFNs can be designed to bind to a specific genomic DNA sequence and effect permanent knockout of the targeted gene19, 45, 46, 47. Only transient expression of the ZFNs is required during a brief period of ex vivo culture, and the genetic mutation is present for the life of the cell and its progeny. Thus, a major shortcoming of other gene therapy technologies-the need for continued expression of a foreign transgene-is avoided. Moreover, unlike approaches based on small molecules, antibodies or RNA interference44, ZFN-mediated gene disruption can completely eliminate CCR5 from the surface of cells through bi-allelic modification. By using an optimized nucleofection procedure, we were able to overcome the technical challenges to ZFN-induced genome editing in CD34+ cells previously reported21 and achieve, on average, disruption at 17% of the loci, which we estimate will produce 5-7% bi-allelically modified cells.
The safety and efficacy of T lymphocytes modified with CCR5-targeted ZFNs are currently being evaluated in a phase 1 clinical trial. In a preclinical study, investigation of the specificity of the same CCR5-targeted ZFNs as used in this study revealed off-target cleavage events in T cells at significant levels only at the homologous CCR2 locus19. Studies in mice have not detected any deleterious phenotype associated with loss of CCR2 (ref. 48), and human genetic studies have even suggested a beneficial phenotype from the loss of this gene in HIV-infected individuals49. Although not analyzed here, modification of CD34+ HSPCs with these same CCR5 ZFN reagents is likely to result in similar, low levels of off-target cleavage events. Any safety concerns associated with nonspecific cleavage must be evaluated in larger, future studies.
Although T lymphocytes are the primary target of HIV-1 infection, ZFN modification of HSPCs may allow longer-term production of CCR5-/- cells in patients. The scientific rationale for CCR5 modification of HSPCs is supported by the recent finding that an HIV+ leukemia patient receiving a transplant from a CCR5-/- donor was effectively cured of his infection, despite discontinuing antiretroviral therapy9. As shown by our data, ZFN-modified HSPCs retained full functionality and gave rise to CCR5- cells in lineages relevant to HIV-1 pathogenesis. ZFNs delivered to purified CD34+ cell populations by nucleofection were capable of modifying true SCID-repopulating stem cells, and the high levels of CCR5 editing were maintained after secondary transplantation.
The experimental mouse model of HIV-1 infection used in these studies revealed a strong selection for CCR5- progeny during acute infection with a CCR5-tropic strain of HIV-1. This suggests that CCR5-/- stem cells, even if the minority, produced sufficient numbers of CCR5-/- progeny to support immune reconstitution and inhibit HIV-1 replication. Such selection is consistent with clinical observations from genetic diseases such as adenosine deaminase deficiency (ADA)-SCID, X-linked SCID and Wiskott-Aldrich syndrome, in which normal hematopoietic cells have a selective advantage, so that spontaneous monoclonal reversions can lead to selective outgrowth of such cells and amelioration of symptoms50, 51, 52, 53.
The observation of almost complete replacement of human T cells in the intestines of the infected mice with CCR5- cells is consistent with this tissue harboring the majority of the body's CD4+CCR5+ effector memory cells. A characteristic feature of HIV-1 replication in mucosal tissues is an ongoing cycle of T-cell death and the recruitment of replacement T cells, which, in an activated state, are highly permissive for HIV-1 infection37. This is especially true in the gut mucosa, a key battleground in HIV-1 infection54, 55, 56. We also observed a strong selection for CCR5- cells in the thymus, suggesting that CCR5- cells would be selected at both a precursor stage in the thymus and at an effector stage in the mucosa. Ultimately, the presence of HIV-resistant CCR5- cells in mucosal tissues should both protect individual cells from infection and help to break the cycle of immune hyperactivation that may underlie much of the pathology of AIDS57.
Although antiretroviral therapy is highly effective in many patients, the associated costs and potential for side effects can be considerable when extrapolated over a lifetime. In contrast, our approach may provide a one-shot treatment that would be most suited to the setting of autologous HSPC transplantation. Procedures for isolating and processing HSPCs for autologous or allogeneic transplantation are well established. The use of a patient's own stem cells may remove the requirement for full ablation of the marrow hematopoietic compartment and the immune suppression that is necessary in allogeneic transplantation. Indeed, the toxicity of such regimens is one reason that allogeneic stem cell transplantation from CCR5Δ32 donors is not a realistic treatment option for HIV+ patients in the absence of other conditions that necessitate the transplant.
Of note, certain HIV-infected individuals, such as AIDS lymphoma patients, already undergo full ablation and autologous HSPC rescue as part of their therapy58 and may be suitable candidates for HSPC-based gene therapies44. In addition, the experience of autologous HSPC transplantation in gene therapy treatments for ADA-SCID59, 60, chronic granulomatous disease61 and X-linked adrenoleukodystrophy62 is that nonmyeloablative conditioning can facilitate engraftment of gene-modified autologous HSPCs with minimal associated toxicity. It is possible that the use of nonmyeloablative regimens, together with the selective advantage conferred on CCR5-/- progeny, could prove an effective combination for HIV+ patients receiving ZFN-treated autologous HSPCs.
Targeting CCR5 is not expected to provide protection against viruses that use alternate co-receptors such as CXCR4. Although only a handful of cases of HIV-1 infection of CCR5Δ32 homozygotes have been reported63, 64, CXCR4-tropic viruses have been associated with accelerated disease progression65, so that selection for such strains could be an undesirable consequence of targeting CCR5. However, this outcome is not generally observed in patients treated with CCR5 inhibitors unless CXCR4-tropic viruses were present before therapy, and resistance to these drugs occurs by viral adaptation to the drug-bound form of CCR5 (refs. 66, 67). Notably, although the patient who received the CCR5Δ32 transplant harbored CXCR4-tropic virus before the procedure, his HIV-1 infection was still controlled long term9, 10. Similar to the recommendations for CCR5 inhibitors, it may be prudent to restrict CCR5 ZFN treatment of HSPCs to individuals with no detectable CXCR4-tropic virus.
In contrast to the acute HIV-1 infection modeled in this study, HIV-1 patients usually present in a chronic phase of the disease, and their viral levels can be effectively controlled by antiretroviral therapy. The requirement for the selective pressure of active HIV-1 replication in the success of this, or other, anti-HIV gene therapies is at present unknown. It has been suggested that low-level viral replication continues in certain sanctuary sites, even in well-controlled patients on antiretroviral therapy43, 68, which could provide a low level of selection, although drug intensification trials have not provided evidence of ongoing replication69. It is also possible that the high levels of CCR5 disruption we achieved without selection, if extrapolated to HIV+ patients, could be sufficient to provide a therapeutic effect even in the absence of a strong selective pressure. Alternatively, ZFN knockout of CCR5 in HSPCs could be viewed as a backup strategy in the event that antiretroviral therapy fails or is withdrawn. It may also be possible to incorporate antiretroviral therapy interruptions into an overall therapeutic strategy, as recently described for HIV-infected individuals receiving autologous HSPCs engineered with anti-HIV ribozymes, where gene-marked progeny were found at higher levels after treatment interruptions70.
In summary, our data demonstrate that transient ZFN treatment of human CD34+ HSPCs can efficiently disrupt CCR5 while yielding cells that remain competent to engraft and support hematopoiesis. In the presence of CCR5-tropic HIV-1, CCR5-/- progeny rapidly replaced cells depleted by the virus, leading to a polyclonal population that ultimately preserved human immune cells in multiple tissues. Our findings indicate that the modification of only a minority of human CD34+ HSPCs may provide the same strong anti-viral benefit as was conferred by a complete CCR5Δ32 stem cell transplantation in a patient9. And they further suggest that a partially modified autologous transplant, administered under only mildly ablative transplantation regimens may also be effective, opening up the treatment to many more HIV-infected individuals. Finally, the identification of conditions that allow the efficient use of ZFNs in human CD34+ HSPCs suggests the use of this technology in other diseases for which HSPC modification may be curative.
Results
Efficient disruption of CCR5 in human CD34+ HSPCs
Gene delivery methods suitable to express ZFNs include plasmid DNA nucleofection16, integrase-defective lentiviral vectors21 and adenoviral vectors19. Although nonviral methods are attractive, nucleofection can be associated with relatively high toxicity for human CD34+ HSPCs and loss of engraftment potential22, although, more recently, less toxic outcomes have been described23, 24, 25. We evaluated different parameters to identify nucleofection conditions that allowed efficient disruption of CCR5 while limiting toxicity. The extent of CCR5 disruption was quantified using PCR amplification across the CCR5 locus, denaturation and reannealing of products, and digestion with the Cel 1 nuclease, which preferentially cleaves DNA at distorted duplexes caused by mismatches. The Cel 1 nuclease assay detects a linear range of CCR5 disruption between 0.69% and 44% of the total alleles in a population, with an upper limit of sensitivity of 70-80% disruption (ref. 19 and data not shown). We used this assay to monitor CCR5 disruption as only a minority of human CD34+ cells expresses CCR5 (ref. 26), making it difficult to measure CCR5 expression by flow cytometry.
Using CD34+ HSPCs harvested from umbilical cord blood and optimized nucleofection conditions, we achieved mean disruption rates of 17% ± 10 (n = 21) of the total CCR5 alleles in the population (Fig. 1a). Similar results were also achieved using CD34+ HSPCs isolated from human fetal liver (data not shown). Previous studies in human cell lines16 and primary human T cells19 have shown that the percentage of bi-allelically modified cells in a ZFN-treated population is 30-40% of the total number of disrupted alleles detected by the Cel 1 assay. We therefore estimated that 5-7% of ZFN-treated cells would be CCR5-/-, although this was not directly measured.
We evaluated toxicity by measuring induction of apoptosis. Although nucleofection increased toxicity to human CD34+ cells threefold compared to untreated cells, inclusion of the ZFN plasmids had no additional effect compared to mock nucleofected controls (data not shown). Overall, we consider that any adverse effects of nucleofection on cell viability may be offset by the high levels of CCR5 disruption achieved as well as the speed and simplicity of the procedure compared to viral vector systems19, 21.
ZFN-modified CD34+ HSPCs are capable of multi-lineage engraftment in NSG mice
NSG mice can be engrafted with human CD34+ HSPCs20 and thereby provide a rigorous readout of the hematopoietic potential of genetically modified HSPCs. We evaluated the effects of nucleofection and/or CCR5 disruption by transplanting both untreated and ZFN-treated human CD34+ HSPCs into 1-d-old mice that had received low-dose (150 cGy) radiation. Engraftment of human cells was efficient and rapid, typically resulting in 40% human CD45+ leukocytes in the peripheral blood at 8 weeks after transplantation. The animals showed no obvious toxicity or ill health, as reported for higher radiation doses27. ZFN-treated cells engrafted NSG mice as efficiently as untreated control cells (Fig. 1b), with no statistically significant difference between the two groups (Student's t-test, P = 0.26).
Eight to 12 weeks after transplantation, we analyzed engraftment of various mouse tissues with human CD45+ leukocytes and with cells from specific hematopoietic lineages (Fig. 1c). Human cells were detected using human-specific antibodies, and specificity was confirmed using both unengrafted animals and isotype-matched antibody controls (Supplementary Fig. 1). High levels of human cells were found in both the peripheral blood and tissues, ranging from 5-15% of the intestine, >50% of blood, spleen and bone marrow, and >90% of the thymus (Supplementary Table 1). CD4+ and CD8+ T cells were present in multiple organs, including the thymus, spleen, and both the intraepithelial and lamina propria regions of the small and large intestines; B-cell progenitors were present in the bone marrow; and CD14+ macrophage and/or monocytes were detected in the lung. Of particular interest was the large population of human CD4+CCR5+ cells in the intestines, as these cells are targeted by both HIV-1 in humans28, 29, 30, 31 and SIV in primates32, 33, 34. Overall, the profile of human cells in mice receiving ZFN-treated CD34+ HSPCs was indistinguishable from that of mice transplanted with unmodified cells, both with respect to the percentage of human cells in each tissue and the frequencies of different subsets (Supplementary Table 1), suggesting that ZFN-modified CD34+ HSPCs are functionally normal.
ZFN-treated CD34+ HSPCs produce CCR5-disrupted progeny after secondary transplantation
To evaluate whether ZFN treatment of the bulk CD34+ population modified true SCID-repopulating stem cells, we harvested bone marrow from an animal 18 weeks after engraftment with ZFN-treated CD34+ HSPCs, in which the extent of CCR5 disruption in the bone marrow was 11% (Table 1). This marrow was transplanted into three 8-week-old recipients. At the same time, bone marrow from a control animal engrafted with untreated CD34+ HSPCs was transplanted into three additional animals. Analysis of the peripheral blood of the secondary recipients 8 weeks later revealed that all six animals had engrafted and that there was no significant difference in the percentage of human CD45+ leukocytes between the ZFN-treated and control groups. Furthermore, human cells in the blood of the ZFN cohort had levels of CCR5 disruption that slightly exceeded the level in the original donor marrow (12-20%) (Table 1). These data demonstrate that ZFN activity can lead to permanent disruption of CCR5 in SCID-repopulating stem cells and that such modified cells retain their engraftment and differentiation potential.
Protection of CD4+ T cells in peripheral blood of NSG mice after HIV-1 infection
Engrafted animals at 8-12 weeks after transplantation that had received either unmodified or ZFN-treated CD34+ HSPCs were challenged with the CCR5-tropic virus HIV-1BAL. This strain of HIV-1 causes a robust infection and significant CD4+ T-cell depletion in humanized mouse models35, 36, mimicking the human infection, in which depletion of CD4+CCR5+ lymphocytes results from a combination of direct infection, systemic immune activation36 and the upregulation of CCR5 on thymic precursors37, 38. After infection, blood samples were collected from the mice every 2 weeks and analyzed for HIV-1 RNA levels, T-cell subsets and the extent of CCR5 disruption. At 8-12 weeks after infection, animals were euthanized and multiple tissues analyzed (Supplementary Fig. 2).
Changes in the ratio of CD4+ to CD8+ T cells in the peripheral blood are characteristic of progressive infection in individuals with AIDS39, 40. We therefore examined the CD4/CD8 ratio in blood samples from individual mice both before and after infection and found that the mean ratio before infection was similar for both the untreated and ZFN-treated groups. After HIV-1 challenge, the ratios became highly skewed in the control group owing to the pronounced loss of CD4+ cells, whereas the ZFN-treated animals maintained normal ratios (Fig. 2a,b).
Protection of human cells in mouse tissues after HIV-1 infection
We next analyzed the human cells present in various mouse tissues 12 weeks after infection with HIV-1BAL. NSG mice into which unmodified cells were transplanted displayed a characteristic loss of certain human cell populations, whereas the ZFN-treated cohort retained normal human cell profiles throughout their tissues despite HIV-1 challenge (Fig. 3a). In the intestines and spleen, which are the organs harboring the highest percentage of human CD4+CCR5+ cells in this model (Supplementary Fig. 3), we observed specific depletion of CD4+ T cells from the spleen and the complete loss of all human lymphocytes from the intestines of untreated animals, whereas these populations were fully preserved in the ZFN-treated cohort (Fig. 3b). In the bone marrow, which is not a major target organ of HIV-1 infection, levels of human CD45+ cells were similar in all three groups.
Notably, HIV-1BAL infection resulted in the loss of virtually all human cells from the thymus of mice receiving untreated CD34+ HSPCs by 12 weeks after infection (Fig. 3a). Depletion of thymocytes has been proposed to occur as a consequence of the upregulation of CCR5 on these cells during HIV-1 infection37, 38, and likely contributed both to the observed depletion in the thymus and to the reduction in the numbers of mature CD4+ and CD8+ T cells observed in other tissues.
HIV-1 infection rapidly selects for CCR5- T cells
We examined whether the survival of T cells in the mice receiving ZFN-treated CD34+ HSPCs was the result of selection for ZFN-modified progeny. We measured the percentage of disrupted CCR5 alleles in the blood of mice at sequential time points after HIV-1 challenge, using both the Cel 1 assay and a specific PCR amplification that detects a common 5-bp duplication at the ZFN target site that typically accounts for 10-30% of total modifications19. Both assays revealed a rapid increase in the frequency of ZFN-disrupted alleles, reaching the upper limit of the Cel 1 assay by 4 weeks after infection (Fig. 4a).
We also examined levels of CCR5 disruption in multiple tissues from ZFN-treated animals, either uninfected or 12 weeks after HIV-1BAL challenge, and observed a sharp increase in CCR5 disruption after HIV-1 infection (Fig. 4b). FACS analysis of the spleen and intestine revealed that, in contrast to uninfected animals, in which -25% of CD4+ cells were also CCR5+, very little or no CCR5 expression was detected in the CD4+ T cells that persisted in the ZFN-treated animals (Fig. 4c,d). Together, these data suggest that the protection of CD4+ lymphocytes in ZFN-treated mice was a consequence of selection for CCR5-, HIV-1-resistant cells derived from ZFN-edited cells.
Heterogeneity of CCR5 modifications suggests polyclonal origins
ZFN-induced double-stranded breaks repaired by nonhomologous end-joining result in highly heterogeneous changes at the targeted locus19. We used this property to investigate whether the CCR5- cells that developed in mice that received ZFN-treated CD34+ HSPCs were polyclonal in origin. Sequencing of 60 individual CCR5 alleles amplified from the large intestine of an HIV-1-infected mouse into which ZFN-treated CD34+ HSPCs were previously transplanted revealed that 59 alleles harbored mutations at the ZFN target site (Fig. 5). As previously reported for this ZFN pair19, a high proportion (13 out of 59) of the mutated loci contained a characteristic 5-bp duplication, with the remaining 46 clones bearing 36 unique sequences. In contrast, all alleles sequenced from a mouse receiving untreated CD34+ HSPCs contained the wild-type sequence (data not shown). The high degree of sequence diversity observed strongly suggests that multiple stem or progenitor cells were modified by the ZFNs. These findings also predict that the overwhelming majority of cells selected by HIV-1BAL infection would be CCR5-/-, which is in agreement with the data from flow cytometry analysis (Fig. 4c).
Presence of ZFN-modified cells controls HIV-1 replication in vivo
Quantitative PCR analysis of HIV-1 RNA levels in the peripheral blood of animals revealed that peak viremia occurred at 6 weeks after infection for animals that received transplants of either untreated or ZFN-treated CD34+ HSPCs (Fig. 6a), although the levels were significantly lower (P = 0.03) in the ZFN cohort. By 8 weeks after infection, viral loads in both cohorts were dropping but there continued to be a statistically significant difference between the two groups (P = 0.001). Measurements of p24 levels in the blood by enzyme-linked immunosorbent assay (ELISA) corroborated these findings, with a significant difference (P = 0.02) in antigenemia between the two groups observed by the 6-week time point (data not shown).
These differences between the two cohorts are more striking when the levels of human CD4+ T cells are also considered (Fig. 6a), as the loss of CD4+ T cells in the untreated mice probably contributed to the lowering of overall viral levels seen as the infection progressed. The continued presence of virus in the blood, despite acute loss of CD4+ cells, also occurs during progression to AIDS, where high viral load measurements in serum are typically observed when T-cell death is rapidly occurring41. In contrast, CD4+ T-cell levels in the ZFN-treated mice rebounded after the 2-week nadir and recovered to normal levels by 4 weeks after infection. In contrast to these findings with HIV-1BAL, ZFN-treated mice challenged with a CXCR4-tropic HIV-1 strain did not control viral levels or preserve CD4+ T cells, confirming that the mechanism is CCR5 specific (Supplementary Fig. 4).
We also measured HIV-1 levels in intestinal samples. In tissues harvested at 8 and 9 weeks after infection, viral levels in the ZFN-treated mice were 4 orders of magnitude lower than in the untreated controls. By the 10- and 12-week time points, HIV-1 RNA was undetectable in the ZFN-treated mice (Fig. 6c). This drop in viral load occurred despite the maintenance of normal numbers of human T lymphocytes in the intestines and other tissues (Fig. 3). These observations are consistent with a strong selective pressure for HIV-resistant CCR5-/- cells to replace CCR5-expressing cells, leading to control of viral replication.
Methods
Hematopoietic stem/progenitor cell isolation.
Human CD3+ HSPCs were isolated from umbilical cord blood collected from normal deliveries at local hospitals, according to guidelines approved by the Children's Hospital Los Angeles Committee on Clinical Investigation, or as waste cord blood material from StemCyte Corp. Immunomagnetic enrichment for CD34+ cells was performed using the magnetic-activated cell sorting (MACS) system (Miltenyi Biotec), per the manufacturer's instructions, with the modification that the initial purified CD34+ population was put through a second column and washed three times with 3 ml of the supplied buffer per wash before the final elution. This additional step gave a > 99% pure CD34+ population, as measured by FACS analysis using the anti-CD34 antibody, 8G12 (BD Biosciences).
Nucleofection of CD34+ HSPCs with ZFN expression plasmids.
Freshly isolated CD34+ cells were stimulated for 5-12 h in X-VIVO 10 media (Lonza) containing 2 nM L-glutamine, 50 ng/ml SCF, 50 ng/ml Flt-3 and 50 ng/ml TPO (R&D Systems). 1 x 106 cells were nucleofected with 2.5 µg each of a plasmid pair expressing ZFNs binding upstream (ZFN-L) or downstream (ZFN-R) of codon Leu55 within TM1 of human CCR5 (ref. 19). The CD34+ cell/DNA mix was processed in an X series Amaxa Nucleofector (Lonza) using the U-01 setting and the human CD34+ nucleofector solution, according to the manufacturer's instructions. Following nucleofection, cells were immediately placed in pre-warmed IMDM media (Lonza) containing 26% FBS (Mediatech), 0.35% BSA, 2nM L-glutamine, 0.5% 10-3 mol/l hydrocortisone (Stem Cell Technologies), 5 ng/ml IL-3, 10 ng/ml IL-6 and 25 ng/ml SCF (R&D Systems). Cells were allowed to recover in this media for 2-12 h before injection into mice.
Apoptosis assay.
CD34+ HSPCs were collected at 24 h post-nucleofection and analyzed for the percent of viable cells marked for apoptosis using the PE apoptosis detection kit (BD Biosciences) according to the manufacturer's instructions. Cells were stained with 7-AAD (detects viable cells) and annexin V (detects apoptotic cells) and analyzed using a FACScan flow cytometer (BD Biosciences). This double staining allowed the identification of cells in the early stages of apoptosis.
NSG mouse transplantation.
NOD.Cg-Prkdc scid Il2rg tm1Wj/SzJ (NOD/SCID/IL2rγnull, NSG) mice71 were obtained from Jackson Laboratories. Neonatal mice within 48 h of birth received 150 cGy radiation, then 2-4 h later 1 x 106 ZFN-modified or mock-treated human CD34+ HSPCs in 50 µl PBS containing 1% heparin were injected through the facial vein. For secondary transplantations, bone marrow was harvested by needle aspiration from the upper and lower limbs of 18-week-old animals previously engrafted with human CD34+ HSPCs, filtered through a 70 µm nylon mesh screen (Fisher Scientific) and washed in PBS. The cells were transplanted into three 8-week-old mice that had previously received 350 cGy radiation, using retro-orbital injection of 2 x 107 bone marrow cells per mouse. Mouse cohorts are described in Supplementary Table 2.
Analysis of CCR5 disruption.
The percentage of CCR5 alleles disrupted by ZFN treatment was measured by performing PCR across the ZFN target site followed by digestion with the Surveyor (Cel 1) nuclease (Transgenomic), which detects heteroduplex formation, as previously described19. Briefly, genomic DNA was extracted from mouse tissues and subject to nested PCR amplification using human CCR5-specific primers, with the resulting radiolabeled products digested with Cel 1 nuclease and resolved by PAGE. The ratio of cleaved to uncleaved products was calculated to give a measure of the frequency of gene disruption. The assay is sensitive enough to detect single-nucleotide changes and has a linear detection range between 0.69 and 44%19.
In addition, a common 5-bp (pentamer) duplication that occurs after nonhomologous end-joining repair of ZFN-cleaved CCR5 (ref. 19) was detected by PCR. The first-round PCR product generated during Cel 1 analysis was diluted 1:5,000 and 5 µl used in a Taqman qPCR reaction using primers (5'-GGTCATCCTCATCCTGATCTGA-3' and 5'-GATGATGAAGAAGATTCCAGAGAAGAAG-3') and probe 5'-FAM d(CCTTCTTACTGTCCCCTTCTGGGCTCAC) BHQ-1-3' (Biosearch Technologies), and analyzed using a 7,900HT real-time PCR machine (Applied Biosystems). At the same time, 5 µl of a 1:50,000 dilution of the PCR product were used in a Taqman qPCR reaction using primers(5'- CCAAAAAATCAATGTGAAGCAAATC-3' and 5'- TGCCCACAAAACCAAAGATG -3') and probe 5'- FAM d(CAGCCCGCCTCCTGCCTCC) BHQ-1-3' to detect total copies of human CCR5. Data were analyzed using software supplied by the manufacturer and the frequency of pentamer insertions in CCR5 calculated. The assay is sensitive enough to detect a single pentamer insertion event in 100,000 cells (data not shown).
ZFN-induced modifications of CCR5 were analyzed by directly sequencing cloned CCR5 alleles, isolated by PCR amplification as described above, and TOPO-TA cloning (Invitrogen). Plasmid DNA was isolated from 60 individual bacterial colonies for each tissue analyzed.
HIV-1 infection and analysis.
A cell-free virus stock of HIV-1BaL and a molecular clone of HIV-1NL4-3 were obtained from the AIDS Research and Reference Reagent Program (ARRRP), Division of AIDS, NIAID, NIH from material deposited by Suzanne Gartner, Mikulas Popovic, Robert Gallo and Malcolm Martin. HIV-1BaL virus was propagated in PM1 cells, obtained from the ARRRP and deposited by Marvin Reitz and harvested 10 d post-infection. HIV-1NL4-3 viruses were generated by transient transfection of 293T cells (ATCC). Viruses were titrated using the Alliance HIV-1 p24 ELISA kit (PerkinElmer) and by TCID50 analysis on U373-MAGI cells (ARRRP, deposited by Michael Emerman and Adam Geballe). Mice to be infected with HIV-1 were anesthetized with inhalant 2.5% isoflourane and injected intraperitoneally with virus stocks containing 200 ng p24, 7 x 104 TCID50 units, in 100 µl total volume.
HIV-1 levels in peripheral blood or tissues harvested at necropsy were determined by extracting RNA from 5 x 105 cells using the master pure complete DNA and RNA purification kit (Epicentre Biotechnologies) and performing Taqman qPCR using a primer and probe set targeting the HIV-1 LTR region, as previously described72. In addition, p24 levels were measured in blood samples by ELISA.
Mouse blood and tissue collection.
Peripheral blood samples were collected every 2 weeks starting at 8 weeks of age, using retro-orbital sampling. Whole blood was blocked in FBS (Mediatech) for 30 min., the red blood cells were lysed using Pharmlyse solution (BD Biosciences) and cells were washed with PBS. Tissue samples were collected at necropsy and processed immediately for cell isolation and FACS analysis, or kept in freezing media (IMDM plus 20% DMSO) in liquid nitrogen, for later analysis and DNA extraction. Tissue samples were manually agitated in PBS before filtering through a sterile 70 µm nylon mesh screen (Fisher Scientific) and suspension cell preparations produced as previously described19. Intestinal samples were processed as previously described73, with the modification that the mononuclear cell population was isolated after incubation in citrate buffer and collagenase enzyme for 2 h, followed by nylon wool filtration (Amersham Biosciences) and ficoll-hypaque gradient isolation (GE Healthcare).
Analysis of human cells in mouse tissues.
FACS analysis of human cells was performed using a FACSCalibur instrument (BD Biosciences) with either BD CellQuest Pro version 5.2 (BD Biosciences) or FlowJo software version 8.8.6 for Macintosh (Treestar). The gating strategy performed was an initial forward scatter versus side scatter (FSC/SSC) gate to exclude debris, followed by a human CD45 gate. For analysis of lymphocyte populations in peripheral blood, a further lymphoid gate (low side scatter) was also applied to exclude cells of monocytic origin74. All antibodies used were fluorochrome conjugated and human specific, and obtained from BD Biosciences: CD45 (clone 2D1), CD19 (clone HIB19), CD14 (clone MΦP9), CD3 (clone SK7), CD4 (clone SK3), CD8 (clone HIT8a), CCR5 (2D7). Gates were set using fluorescence minus one controls, where cells were stained with all antibodies except the one of interest. Specificity was also confirmed using isotype-matched nonspecific antibodies (BD Biosciences) (Supplementary Fig. 1) and with tissues from animals that had not been engrafted with human cells.
Immunohistochemical analysis of human CD3 and CD4 expression, respectively, in the small intestine and spleen tissue from HSPC-engrafted mice was performed on fixed paraffin-embedded tissue sections, as previously described73. Controls included isotype-matched nonspecific antibodies and unengrafted NSG mice.
Statistical analysis.
All statistical analysis was performed using GraphPad Prism version 5.0b for Mac OSX (GraphPad Software). Unpaired two-tailed t-tests were performed assuming equal variance to calculate P-values. A 95% confidence interval was used to determine significance. A minimum of three data points was used for each analysis.
| |
| |
| |
|
|
|
